ID: 947432763

View in Genome Browser
Species Human (GRCh38)
Location 2:230045181-230045203
Sequence ATTTCCTCACTCTACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 220}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947432755_947432763 27 Left 947432755 2:230045131-230045153 CCTTCAAATGGGTAAGGAGCCCG 0: 1
1: 0
2: 0
3: 1
4: 53
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220
947432757_947432763 7 Left 947432757 2:230045151-230045173 CCGTCAGTATTCCATCACCCCAT 0: 1
1: 0
2: 0
3: 14
4: 147
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220
947432759_947432763 -10 Left 947432759 2:230045168-230045190 CCCCATCCACTTTATTTCCTCAC 0: 1
1: 0
2: 1
3: 36
4: 342
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220
947432758_947432763 -4 Left 947432758 2:230045162-230045184 CCATCACCCCATCCACTTTATTT 0: 1
1: 0
2: 1
3: 39
4: 503
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220
947432756_947432763 8 Left 947432756 2:230045150-230045172 CCCGTCAGTATTCCATCACCCCA 0: 1
1: 0
2: 1
3: 6
4: 96
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220
947432754_947432763 30 Left 947432754 2:230045128-230045150 CCACCTTCAAATGGGTAAGGAGC 0: 1
1: 0
2: 0
3: 7
4: 82
Right 947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG 0: 1
1: 0
2: 2
3: 11
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947432763 Original CRISPR ATTTCCTCACTCTACCAGCC TGG Intronic
901855492 1:12041874-12041896 CTTTCCTCAGTCTCCCTGCCTGG + Intergenic
904353853 1:29925964-29925986 ACTTGGTCACTCTACCTGCCAGG + Intergenic
905133202 1:35777197-35777219 TTCTCCTCCCTGTACCAGCCTGG - Intergenic
906448114 1:45921441-45921463 CTTGCCTCAAGCTACCAGCCTGG + Intronic
910225851 1:84935303-84935325 ATTTCCCCAATATATCAGCCTGG + Intronic
910988632 1:93031109-93031131 ATTTCCTCAGTCTATCAGTCTGG + Intergenic
913188276 1:116390169-116390191 ATTACTTCACTCAACCAGGCTGG - Intronic
915587125 1:156849926-156849948 TTTTCCTCACTCTGTCATCCAGG + Intronic
916949193 1:169761634-169761656 ATTGCATCACTGCACCAGCCTGG - Intronic
917670538 1:177269569-177269591 AATTCCTCACTGCAGCAGCCTGG + Intronic
918225334 1:182476102-182476124 ATTACCTCACTGTACAACCCTGG - Intronic
920462083 1:206148614-206148636 ATTTCCACACTCTGCAAGACAGG + Intergenic
921939038 1:220821077-220821099 AGGGCCTCACTCTACCACCCAGG - Intergenic
1064001224 10:11665168-11665190 ATTTCCTCATGCTTCCAGCAGGG + Intergenic
1066423154 10:35280299-35280321 CTTTCCTCACTCTTTCACCCAGG - Intronic
1067337424 10:45376473-45376495 ACTTCCTCATTCTCCCAGCTTGG + Intronic
1068678556 10:59793756-59793778 TTTTCCTCACTCTGTCATCCAGG - Intronic
1074904723 10:117851736-117851758 ATTTCCTGGCTGTACCTGCCCGG + Intergenic
1075559073 10:123455542-123455564 ATTTCCTCTCCCCATCAGCCTGG - Intergenic
1075761103 10:124857541-124857563 AGTTTCTCACTCTGCCATCCAGG + Intergenic
1076102251 10:127792368-127792390 CTTTCTTCACTCTCCGAGCCTGG - Intergenic
1077563874 11:3283890-3283912 TTTTCCTCACGCTACCTGGCTGG + Intergenic
1077569763 11:3329707-3329729 TTTTCCTCACGCTACCTGGCTGG + Intergenic
1078404992 11:11062789-11062811 ATTTCCTCAACCTACCAGGCAGG + Intergenic
1078546821 11:12252963-12252985 CTTCCCTCACTCTACGATCCTGG + Intronic
1081771748 11:45654458-45654480 ATGTCCCCGCTCTCCCAGCCTGG + Intronic
1082843038 11:57704837-57704859 ATTTCCTCCCTCTACTCACCTGG - Intronic
1083188416 11:61032037-61032059 ATTTACTCACTCTGTCACCCAGG + Intergenic
1084712364 11:70851887-70851909 TCTGCCTCACTTTACCAGCCTGG - Intronic
1084756818 11:71245004-71245026 TTTTCCTCACTCTGTCACCCAGG + Intronic
1085268939 11:75258422-75258444 AGTTTCTCACTCTGCCACCCAGG + Intergenic
1088381788 11:109201156-109201178 ATTTCTTCACACTTCAAGCCTGG - Intergenic
1090821677 11:130348059-130348081 TCTTCCTCACTCTTCCAGCACGG + Intergenic
1091460182 12:638280-638302 ATTTCCTCTCTACTCCAGCCAGG + Intronic
1092412686 12:8266184-8266206 AGGTCCTCACTCTGTCAGCCAGG - Intergenic
1094102389 12:26778157-26778179 TAGTCCTCACTCTACCAGTCAGG - Intronic
1094651712 12:32385040-32385062 ATGGCCTCACTCTGCCACCCAGG + Intergenic
1095784478 12:46094475-46094497 ATTGCCTTTCTCTAGCAGCCTGG + Intergenic
1095805488 12:46314817-46314839 AGTTCCTCACTCTGTCACCCAGG + Intergenic
1098440004 12:70507614-70507636 ATTTCCTCCTTCCACCAGTCTGG - Intergenic
1098641111 12:72839288-72839310 TATTCCTCATTCTACCAGGCAGG + Intergenic
1099335315 12:81348708-81348730 TTTTTCTCACTCTGCCACCCAGG - Intronic
1099735651 12:86563941-86563963 TAGTCCTCACTCTACCAGCCAGG - Intronic
1101775403 12:107788861-107788883 ATTTCCCCATTCTCCCAGGCGGG + Intergenic
1103724007 12:122989006-122989028 CTTGCCTCACTCACCCAGCCTGG - Intronic
1105061111 12:133151863-133151885 AATTTCTCTCTCCACCAGCCAGG - Exonic
1105992176 13:25632879-25632901 TTTTCCTCACTTTCCCAGCGAGG + Intronic
1107168676 13:37314226-37314248 GTTTCCTCTCTCTTTCAGCCCGG - Intergenic
1108508698 13:51135849-51135871 ATTTCCTCTCTGTATCAGTCAGG + Intergenic
1108904151 13:55448866-55448888 GTGCCCTCACTCTACCAGTCAGG - Intergenic
1108934773 13:55870636-55870658 CTTAGCTCACACTACCAGCCCGG + Intergenic
1113614799 13:111672380-111672402 ATTTGTTTACTCTCCCAGCCTGG + Exonic
1113620268 13:111757294-111757316 ATTTGTTTACTCTCCCAGCCTGG + Intergenic
1119375047 14:74184104-74184126 ATTTTCTCACTCTGTCACCCAGG + Intronic
1121358264 14:93232562-93232584 ATTTCCTCCCAGTGCCAGCCCGG - Intergenic
1122615501 14:103015096-103015118 AGTTCCTCCCACTTCCAGCCTGG - Intronic
1123097950 14:105775232-105775254 TGTTCCTCACACTCCCAGCCCGG + Intergenic
1123433917 15:20241103-20241125 ATTGTCTCACTCTATCACCCAGG + Intergenic
1125277711 15:38010776-38010798 AGTGCCTCACTCTGCCACCCAGG + Intergenic
1125664315 15:41417642-41417664 ACTTCCTATCTCTCCCAGCCCGG - Intronic
1126018039 15:44372387-44372409 ATTTTCTTACTCTAACAGCAGGG - Intronic
1128658143 15:69477541-69477563 AGAGCCTCACTCTACCACCCAGG - Intergenic
1130959955 15:88652718-88652740 TCATCCTCACTCTACCAGCCAGG - Intronic
1132305461 15:100808558-100808580 CTTGGCTCACACTACCAGCCTGG - Intergenic
1132592152 16:730755-730777 ACTTCCTCCCACTCCCAGCCTGG + Intronic
1136221718 16:28833612-28833634 ATCTCCTCACACTGCCTGCCAGG - Intronic
1137636747 16:49993257-49993279 ATTGCCTCACTACTCCAGCCTGG + Intergenic
1139151087 16:64382229-64382251 CTTGACTCACTTTACCAGCCTGG - Intergenic
1139251639 16:65502176-65502198 ATTTCAGCACATTACCAGCCTGG + Intergenic
1139353687 16:66354029-66354051 GTCTCCTCGCTCTGCCAGCCAGG + Intergenic
1141484141 16:84327859-84327881 ATTTGTTCACTATACCACCCTGG - Intronic
1142011500 16:87717309-87717331 ATTTCCTTGCTCTACCAGATGGG - Intronic
1142292195 16:89198332-89198354 ATTTGCTCTCTCTCCCAGGCTGG - Exonic
1142870046 17:2814195-2814217 AAATCCTGACTCTACCAGCTGGG + Intronic
1143190899 17:5039496-5039518 AATTTCTCACTCTGCCACCCAGG + Intronic
1143834577 17:9680332-9680354 AGTTCCTCCCTCACCCAGCCAGG + Exonic
1144792716 17:17870187-17870209 ATTTCCTCTTTCGGCCAGCCAGG - Intronic
1145237228 17:21216737-21216759 ACTTGCTCACACTGCCAGCCAGG + Intergenic
1145706829 17:26878788-26878810 AGTTCCTCACTCTGTCACCCTGG - Intergenic
1145876693 17:28323955-28323977 ATCACCACACTCCACCAGCCTGG + Intronic
1146280144 17:31539495-31539517 ATTGCCTCAGTTTACCATCCTGG + Intergenic
1146461064 17:33046490-33046512 ACTCCCTCACACTCCCAGCCTGG - Intronic
1146897708 17:36557210-36557232 ATTTCCAGACTCTACAAGCTGGG - Exonic
1147194235 17:38754581-38754603 ATTCTCTGACTCTACCAGACAGG - Intronic
1147692012 17:42321847-42321869 AGTATCTCACTCTATCAGCCAGG + Intronic
1147763721 17:42818730-42818752 AATTACCCACTCTCCCAGCCAGG + Intronic
1148202443 17:45758261-45758283 ACTTCCTCTCCCTCCCAGCCAGG + Intergenic
1148653502 17:49266448-49266470 ATTTCCTCCCTCTACTGCCCAGG - Intergenic
1148712422 17:49691540-49691562 ATTTCTTAACTCTGCCAGGCAGG + Intergenic
1149635128 17:58160759-58160781 GTTTGCTGATTCTACCAGCCCGG + Intergenic
1150009779 17:61492999-61493021 ATTTCCTGACTCTACCAGCTTGG - Intergenic
1151641640 17:75399713-75399735 ATTGCGTCACTACACCAGCCTGG - Intronic
1153232843 18:2956366-2956388 ATTTCCTGGCTCTGCCAGCTTGG + Intronic
1154108514 18:11546283-11546305 GTTTCCTAACTCTACCAGCAAGG - Intergenic
1156407363 18:36795546-36795568 ATTTCCTCCCTCTACAGTCCTGG - Intronic
1156572953 18:38279735-38279757 ATTCCCTTACTTTACCAGGCTGG + Intergenic
1157272453 18:46286851-46286873 GTTCCCTCTCTCTACCAGTCGGG - Intergenic
1158788162 18:60740657-60740679 CTTGGCTCACACTACCAGCCTGG - Intergenic
1159254086 18:65923114-65923136 ACTGTCTCACTCTACCACCCAGG + Intergenic
1159749904 18:72287025-72287047 GTTCCCTCACTCTTCCACCCTGG - Intergenic
1160708937 19:541913-541935 GTTTCCTGACACTACCAGCCTGG + Exonic
1161931758 19:7345293-7345315 TTTTTCTCACTCTATCACCCAGG + Intergenic
1162189305 19:8932273-8932295 ATGTCCTCACTATACCACCTTGG - Intronic
1163461929 19:17443871-17443893 ATTTCATTCCTTTACCAGCCCGG + Intronic
1166019399 19:40012046-40012068 CTTGCCTTACTCTACTAGCCAGG + Intronic
1167067044 19:47194218-47194240 ATTCATTCACTCCACCAGCCTGG - Intronic
929239463 2:39639228-39639250 ATTTGTTCACGCTCCCAGCCTGG + Intergenic
931150935 2:59572604-59572626 ATTTCCTCCACTTACCAGCCTGG + Intergenic
932050760 2:68395676-68395698 TCTTCCTCACTCTTCCTGCCTGG - Exonic
932272939 2:70426560-70426582 AAGTCCTCACTCTACCACCATGG - Intergenic
932432645 2:71685115-71685137 CTTTCCTTCCTCTCCCAGCCAGG - Intronic
932572323 2:72944543-72944565 ATATCCTAAATTTACCAGCCTGG + Exonic
937499984 2:122467691-122467713 AATTCCTCTCTCTACCACCTTGG + Intergenic
937637478 2:124172436-124172458 ATGGCCTCACTCTATCACCCAGG + Intronic
940396627 2:153197853-153197875 ATTTCCCCACCCTAGCAGCAAGG - Intergenic
942551979 2:177129258-177129280 ATTTTCTAACCCTCCCAGCCAGG - Intergenic
943344263 2:186719174-186719196 CTTTCCCCACTCTCCCAGCATGG + Intronic
945713169 2:213326071-213326093 ATTTCCTTACTGTAAAAGCCTGG - Intronic
947096916 2:226577065-226577087 CTTCCCTTACTCTACCACCCTGG + Intergenic
947327112 2:228991548-228991570 CTTGGCTCACACTACCAGCCTGG + Intronic
947432763 2:230045181-230045203 ATTTCCTCACTCTACCAGCCTGG + Intronic
947622621 2:231600582-231600604 ATTTCCTCACTCAACAAATCAGG + Intergenic
948175810 2:235941911-235941933 TTTTCCTCACTCTTCCATACCGG - Intronic
1169293238 20:4370747-4370769 AATTCCTCAATCTGCCATCCAGG - Intergenic
1170043714 20:12064592-12064614 CTTGGCTCACGCTACCAGCCTGG + Intergenic
1174131098 20:48343832-48343854 TTTTCCTCACTCCTGCAGCCTGG - Intergenic
1174671383 20:52311039-52311061 CTTTCCTCCCTCTACCACTCTGG - Intergenic
1177828628 21:26111709-26111731 TTTTCCTCACTCTGTCACCCAGG - Intronic
1179620521 21:42612715-42612737 ATTTTCTCACTTTGACAGCCTGG + Intergenic
1181107577 22:20584152-20584174 ATCACCTCACTCTGCCAACCAGG + Intronic
1184961722 22:47934087-47934109 CATTCCTCCCTGTACCAGCCAGG + Intergenic
1184985057 22:48126193-48126215 ATCACATCACTGTACCAGCCTGG + Intergenic
1185397770 22:50601283-50601305 ATTTCCACTCTCTCCCGGCCGGG - Intronic
949474382 3:4429824-4429846 AATTCCTCAGGCTGCCAGCCTGG + Intronic
951370877 3:21846182-21846204 AATTCCTCACTCTACCATGTTGG - Intronic
951602752 3:24394628-24394650 CTTTCCTCACTCAAACAGGCAGG + Intronic
951923320 3:27879668-27879690 AATATCTCACTCTACCACCCAGG + Intergenic
952163199 3:30716669-30716691 ATTGCCTCCTTCTACTAGCCAGG - Intergenic
953225300 3:41013490-41013512 ATTTCCCCACTCTATCACTCTGG - Intergenic
954551731 3:51487616-51487638 GTTGCCACATTCTACCAGCCTGG - Intronic
957874485 3:86128232-86128254 ATACCCTCACTCCACCAGTCAGG - Intergenic
958498266 3:94873944-94873966 CTTAGCTCACGCTACCAGCCCGG + Intergenic
959476931 3:106822520-106822542 CTTGCCTCAGGCTACCAGCCTGG - Intergenic
960333990 3:116393533-116393555 CTTGACTCACACTACCAGCCTGG - Intronic
962180065 3:133197370-133197392 TTTTCCTCACTCTACCACTGCGG - Intronic
962851826 3:139313870-139313892 ATTTCCTCAGTCTAGCTCCCTGG - Intronic
963676506 3:148317950-148317972 ATTTGCTAAACCTACCAGCCTGG - Intergenic
964945885 3:162222966-162222988 ATTTCCTCATCCTACTAGCCTGG - Intergenic
967074060 3:185986531-185986553 GTTTCCTTCATCTACCAGCCCGG - Intergenic
967365998 3:188687238-188687260 ATTTCCTCTCTCCCCCACCCTGG + Intronic
969943900 4:10762933-10762955 ATTACCTCACTCTAGCAGCTAGG - Intergenic
970462359 4:16287707-16287729 AGTTCCTCCCTTGACCAGCCTGG - Intergenic
971052409 4:22876078-22876100 ACTACCCCACTCTGCCAGCCTGG + Intergenic
971257004 4:25023602-25023624 ATGTCCACACTGTACCAGTCAGG + Intronic
971938663 4:33187787-33187809 CTCTGCTCACACTACCAGCCTGG + Intergenic
972141079 4:35959937-35959959 ATTTTATCACTCTTCCACCCAGG - Intronic
973807298 4:54538753-54538775 ATTTTCTCACTCTGTCACCCAGG + Intergenic
974382115 4:61154393-61154415 ATTTTATCACTCTATCACCCAGG - Intergenic
974564657 4:63567211-63567233 AGGCCCTCACCCTACCAGCCAGG - Intergenic
976885202 4:89974391-89974413 CTTTCCTCACTCTAGCACACTGG + Intergenic
981321793 4:143400307-143400329 CTTTTCACACTCTACCATCCAGG - Intronic
986799877 5:11247516-11247538 CTCTCTTCACTTTACCAGCCAGG - Intronic
987607857 5:20161431-20161453 AGTTCCTCACTGAACAAGCCAGG + Intronic
988742194 5:34087444-34087466 GTATGCTCACTCAACCAGCCTGG + Intronic
989366245 5:40659039-40659061 ATCTCTTCACTCAACCAGACTGG + Intergenic
989713287 5:44427495-44427517 TTTTCCTCACTCTGTCACCCAGG - Intergenic
990079390 5:51893913-51893935 TTTTTCTCACTCTATCACCCAGG - Intergenic
991494924 5:67217413-67217435 ATTTCCTCACTATGCAAGTCAGG + Intergenic
991909785 5:71550358-71550380 TTTTCCTCACTCTATCACCCAGG - Intronic
992064517 5:73093490-73093512 TTTTCCTCACTCTGTCACCCAGG - Intergenic
992848695 5:80781491-80781513 TTTTCCTCGCTCTGCCACCCAGG + Intronic
994245255 5:97470301-97470323 CTTGGCTCACACTACCAGCCTGG + Intergenic
994449807 5:99928552-99928574 CTTGGCTCACACTACCAGCCTGG + Intergenic
995609186 5:113890858-113890880 ATGGCCTCAGCCTACCAGCCAGG + Intergenic
995758583 5:115539773-115539795 ATATCCTAAGTCTAACAGCCTGG + Intronic
997917996 5:137948429-137948451 ATTTTCTCACTCTGTCATCCAGG + Intronic
998729582 5:145059664-145059686 ATTTCCTTACTTTACCATTCTGG - Intergenic
999045006 5:148457499-148457521 ATTTCCTGATAATACCAGCCTGG - Intronic
999068695 5:148719011-148719033 ATTTCCTCCCTCTTCCTGCCCGG + Intergenic
1000800872 5:165724779-165724801 CATTCTTCACTCTACTAGCCAGG - Intergenic
1004758885 6:18643926-18643948 ATTTCCTCCCTTTACCAGTAAGG - Intergenic
1010167113 6:72928861-72928883 AATTCTTCACTCAACCACCCAGG + Intronic
1011472434 6:87721403-87721425 TTTTCCTCACTCTATTACCCAGG + Intergenic
1012764041 6:103341564-103341586 ATTTTCTCACACTGTCAGCCAGG + Intergenic
1014534340 6:122597741-122597763 CTTCCCTCACCCTACCAGTCAGG + Intronic
1014632957 6:123810130-123810152 ATATCCTCACTTTACCAGGGAGG + Intronic
1015743504 6:136484723-136484745 AGGTCCTCACTCTGCCACCCAGG + Intronic
1017154682 6:151312430-151312452 ATTGCACCACTGTACCAGCCTGG + Intronic
1018095855 6:160386569-160386591 CTTCCCTCACTCTGCCCGCCTGG - Intronic
1018156008 6:160985980-160986002 TTTTCCTCACTCTGTCACCCAGG + Intergenic
1021107957 7:16660493-16660515 TTTTCCTCACTCTAGCCACCTGG + Intronic
1023641321 7:42262081-42262103 TTTTTCTCACTCTCTCAGCCAGG + Intergenic
1026272347 7:68847622-68847644 ATTTACTCACTGTACAATCCAGG - Intergenic
1026354991 7:69549776-69549798 CTCTCCTCACTCTACGAACCTGG + Intergenic
1026849681 7:73717081-73717103 GTTTCCTCACTCTGCAGGCCCGG - Intronic
1029975802 7:104832062-104832084 GTTTTCTCACTCTTCCAGCTTGG - Intronic
1031087020 7:117312391-117312413 ATTTGTCCACTCTTCCAGCCTGG - Intronic
1031128995 7:117809118-117809140 ATTTCCTTTCACTATCAGCCAGG + Intronic
1035252248 7:157605108-157605130 TTTGGCTCACACTACCAGCCTGG + Intronic
1035328661 7:158082443-158082465 TTTTGCTCATTCTCCCAGCCAGG + Intronic
1037750635 8:21679907-21679929 AGTTCCTCTCTCTACCAGGCAGG + Intergenic
1040098171 8:43469089-43469111 ATTTCCTCATGCTTCCAGCAGGG - Intergenic
1040363190 8:46686987-46687009 TTTTCCTCTCTCACCCAGCCTGG + Intergenic
1046124864 8:109893108-109893130 TTATCCTCACTCCACTAGCCTGG + Intergenic
1047664816 8:127079993-127080015 ATTCCCTTTCTCTACCAGTCTGG - Intergenic
1050158984 9:2697586-2697608 ATCTCCTCAACCCACCAGCCAGG - Intergenic
1050494934 9:6230645-6230667 ATTTCCTCTCCTTATCAGCCAGG + Intronic
1051029537 9:12658085-12658107 CTGGCCTCACTCTCCCAGCCTGG + Intergenic
1051486893 9:17618347-17618369 ATTTCCTAACTCTCCAACCCTGG - Intronic
1052935753 9:34091610-34091632 GGGTCCTCACTCTATCAGCCAGG - Intronic
1053128351 9:35600528-35600550 CTTGGCTCACGCTACCAGCCTGG - Intergenic
1056132576 9:83600676-83600698 AAGGCCTCACTCTATCAGCCAGG - Intergenic
1057817410 9:98305789-98305811 TTTCCCTCACTCTGCCACCCAGG - Intronic
1058505176 9:105659465-105659487 ATTTACTGACACTACGAGCCAGG - Intergenic
1061267476 9:129515177-129515199 CTCAGCTCACTCTACCAGCCTGG - Intergenic
1061272262 9:129550195-129550217 CTTTCCTCCCTCTCCCCGCCCGG + Intergenic
1061574006 9:131495035-131495057 ACTTCCCATCTCTACCAGCCAGG - Intronic
1062694639 9:137867155-137867177 AGCTCCTCACTCTCCCATCCCGG + Intronic
1203789759 EBV:144488-144510 ATTTCCTCCCTTTCCTAGCCAGG + Intergenic
1185552294 X:992819-992841 CTTTCCTCACTCTGTCACCCAGG - Intergenic
1185942588 X:4338347-4338369 ATTTCCTTGGTCTACCAGCTGGG + Intergenic
1186377332 X:9018468-9018490 ATCTCCTCACTTTTCTAGCCAGG - Intergenic
1188449747 X:30296208-30296230 AATTGCTCACTGTATCAGCCAGG + Intergenic
1188600675 X:31959788-31959810 TTTTCCTCACTCTGTCACCCAGG + Intronic
1189288552 X:39869197-39869219 ATTTCCTCCCTCTCCCAGCCAGG + Intergenic
1192178746 X:68902431-68902453 AGTTCCTGACTCCCCCAGCCAGG + Intergenic
1193089857 X:77482397-77482419 AGTTACTCACTCTGCCATCCAGG - Intergenic
1194765256 X:97841909-97841931 ATCTCCTCTCCCTACCTGCCAGG + Intergenic
1197566798 X:128098312-128098334 GTTTCCTCCATCTACCATCCAGG + Intergenic
1199231327 X:145438911-145438933 ATTTCCTCACTTTACCATTAAGG - Intergenic
1199780626 X:151055785-151055807 AGTTTCTCACTCTGCCACCCAGG + Intergenic
1200244004 X:154513109-154513131 ATTTCCTCCTTCCACCTGCCAGG - Intronic
1200842104 Y:7792823-7792845 AAATCCTCACTCTAGTAGCCAGG + Intergenic
1200988387 Y:9326604-9326626 ATTTCTTCCCTCTGCCAGCGCGG + Intergenic