ID: 947434430

View in Genome Browser
Species Human (GRCh38)
Location 2:230060726-230060748
Sequence GAGGATAAGGAGCAGGAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 529}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947434430 Original CRISPR GAGGATAAGGAGCAGGAGTC GGG Intronic
900830441 1:4961488-4961510 CAGGACAAGGAGCATGAGCCAGG + Intergenic
901054906 1:6444526-6444548 GAGGCTAAGCAGCCGGATTCAGG + Exonic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
902762282 1:18590022-18590044 GAGGAGAAGGAGGAGGGCTCTGG - Intergenic
903337226 1:22633269-22633291 GAGGAGGAGGAGGAGGAGACTGG + Intergenic
903929082 1:26851915-26851937 GAGGATGGGGAGGAGAAGTCAGG - Intronic
904110672 1:28123629-28123651 GGTGAGGAGGAGCAGGAGTCTGG + Intergenic
904406724 1:30295843-30295865 GAGGATAAGGGACAGGTGTGTGG - Intergenic
905584530 1:39106030-39106052 GAGGAGGAGGAGGAGGAGTTGGG + Intronic
905676646 1:39830568-39830590 GAGAATAATGGGCAGGAGCCAGG - Intergenic
905742363 1:40383315-40383337 GAGGATAAGAGGCAGGAGCAGGG - Intronic
906180854 1:43817625-43817647 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
906192390 1:43906258-43906280 GAAGAGGAGGAGGAGGAGTCAGG - Intronic
906254699 1:44339175-44339197 GTGGATATGGAGCAGAACTCCGG + Exonic
906511739 1:46413948-46413970 GAGGTTGTGGAGCAGGAGACTGG - Intergenic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
908349165 1:63267111-63267133 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
908667723 1:66510810-66510832 GAGGGTAATGACCAGCAGTCTGG + Intergenic
908705348 1:66947906-66947928 GAGGATAAGGAGCCGGCCTTGGG - Intronic
908812890 1:68002011-68002033 GAGGAGAAGGAGGAGGAGAAAGG - Intergenic
909727912 1:78857979-78858001 GGGGATGAGGGGCAGCAGTCTGG - Intergenic
910745565 1:90570425-90570447 GAGGCTAGGAAGCAGGAGTTAGG - Intergenic
911226100 1:95307253-95307275 GAGGATAAGGACCTGAATTCTGG - Intergenic
912130673 1:106596138-106596160 GGGGAAAAGGAGCTGGATTCAGG - Intergenic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
914263615 1:146019622-146019644 GAGGAGGAGGAGGAGGAGGCCGG - Exonic
915249218 1:154576566-154576588 GAGGATCTGGAGCAGGTCTCTGG - Exonic
915393393 1:155563365-155563387 GAGGGAAAGGAGCGGGACTCCGG + Intergenic
915409516 1:155689210-155689232 GAGGGAAAGGAGCGGGACTCCGG + Intronic
915743477 1:158138175-158138197 GAGGATAAGGAGGAAGAGATGGG - Intergenic
915951118 1:160190532-160190554 GAGGAATAGGAGCAGGGGGCGGG - Intergenic
916418659 1:164615923-164615945 GAGGTTAAGAGCCAGGAGTCTGG + Intronic
917213741 1:172657075-172657097 GAGGGTAAGGAACAGGTCTCAGG + Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917521359 1:175750742-175750764 GAGGAGAAAGGGCAGGACTCTGG - Intergenic
917637437 1:176950705-176950727 AAGGTCAAGCAGCAGGAGTCGGG + Intronic
917797387 1:178542108-178542130 GAGGAGAAGGGGAAGGTGTCAGG - Intronic
918204669 1:182298194-182298216 GAGGATGTGGGGCAGGAGGCTGG - Intergenic
918315892 1:183322509-183322531 GAGGAGCAGGAGTAGGAGTGGGG - Intronic
918632780 1:186738551-186738573 GAGAATTAGGAGCAGGAAACTGG - Intergenic
919534877 1:198775013-198775035 GAAGAAGATGAGCAGGAGTCAGG - Intergenic
919924659 1:202186175-202186197 GAAGATAAGGAGCAGCAGCAGGG + Intergenic
920062086 1:203233934-203233956 GAGGAGATGGAGCAGGAGGCAGG - Intronic
920309697 1:205041860-205041882 CTGGAAAAGGAGAAGGAGTCGGG - Intergenic
922591319 1:226779411-226779433 TAGGGAAAGGAGCAGGAATCGGG + Intergenic
922766289 1:228158215-228158237 GAGGAGGAGGAGGAGGAGACGGG + Exonic
922798587 1:228353568-228353590 CAGGAGAAGGAGCAAGTGTCAGG + Intronic
924156015 1:241177377-241177399 GAAAATAAGGAACAGGAGCCTGG + Intronic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063214486 10:3912116-3912138 GAGGATCTGGAGCAGGAGCTCGG + Intergenic
1063379711 10:5576720-5576742 GGGGACAAGGAGGAGCAGTCAGG + Intergenic
1064001277 10:11665561-11665583 GAGGAGGAGGAGGAGGAGGCCGG - Intergenic
1064305127 10:14158639-14158661 GAGGAGAAGGAGGAGGAGAAGGG + Intronic
1064867611 10:19899111-19899133 GAAGAGGAGGAGCAGGAGACAGG - Intronic
1066694879 10:38068822-38068844 GAGGATAAAGAGGAGGAGTACGG + Intergenic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1067750508 10:48968423-48968445 GAAGAGAGGGAGCAGGATTCAGG - Intronic
1069083051 10:64108470-64108492 GATGATAAGGATCAGGAATTGGG - Intergenic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069859664 10:71462428-71462450 GAGGAGAAGGAGGAAGAGTGGGG + Intronic
1070398918 10:76035847-76035869 AAGAATTAGTAGCAGGAGTCGGG - Intronic
1072145552 10:92632963-92632985 CAGGGTCAGGAGCCGGAGTCAGG - Intronic
1072245701 10:93542115-93542137 CAGGTTAAGGACCATGAGTCAGG + Intergenic
1074972667 10:118551958-118551980 CAGGATTGGGAGCAGGAGTAGGG + Intergenic
1075099184 10:119493979-119494001 GAAGATGAGGAGCAGGGGTGTGG + Intergenic
1075627728 10:123974552-123974574 AAGGAGAAGGAGCAAGAGTGAGG - Intergenic
1075995403 10:126872775-126872797 GAGGCTGAGGACTAGGAGTCAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076180609 10:128404604-128404626 AAGGAGAAGGTGGAGGAGTCAGG + Intergenic
1076213940 10:128677517-128677539 GTGGATAAGGATGGGGAGTCAGG - Intergenic
1076399765 10:130174322-130174344 GAGGTTAAGAAGCAGCAGCCTGG + Intronic
1076599161 10:131645954-131645976 GAGGAAAAGGAGCAGGTGGAGGG - Intergenic
1077332684 11:1990311-1990333 GAGGTGAAGGTGCAGGGGTCAGG - Intergenic
1077511320 11:2965130-2965152 GAGGAGAAAGAGCAGAAGCCTGG + Intronic
1078480532 11:11671780-11671802 TAGGGTCAGGAGCAGCAGTCGGG + Intergenic
1078580219 11:12533816-12533838 GAGGAGGAGGAGGAGGAGTAGGG + Intergenic
1078849495 11:15151092-15151114 CAGGCTAAGGACCAGGAGTTGGG - Intronic
1079119613 11:17672518-17672540 GAGGACAAGGAGCTGGAAGCAGG - Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1081441252 11:43083959-43083981 GAGGAGGAGGAGGAAGAGTCAGG + Intergenic
1081831060 11:46114813-46114835 GAGGAGAAGGAGCAGCAGAAAGG - Intronic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1083571446 11:63764037-63764059 GAGGAGGAGGAGGAGGAGTGGGG - Exonic
1085027575 11:73245501-73245523 GAGGATAGGGGGAAGGACTCTGG + Intergenic
1085056125 11:73405049-73405071 GAGGATGAGGCCCAGGAGACAGG - Intronic
1085232199 11:74981925-74981947 GAGGCTAAGGAGCAAGAGGTAGG + Intergenic
1085243539 11:75078356-75078378 TAGGATAAAAAGCTGGAGTCAGG - Intergenic
1085379975 11:76106797-76106819 GAGGGCAAGGAGCAGAAGTTGGG + Intronic
1085470177 11:76752663-76752685 GAGGAGAGGAAGGAGGAGTCTGG + Intergenic
1086031117 11:82356777-82356799 GGGGATGAAGAGCAGGAGGCAGG + Intergenic
1086807978 11:91268757-91268779 GAGAGTCAGGAGCAGGAATCGGG + Intergenic
1087058679 11:93957707-93957729 GTGGATAAGAAGCAGGAGACAGG + Intergenic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1089513791 11:119018683-119018705 GAGGAGGAGGAGGAGGAGGCTGG + Exonic
1089784834 11:120900578-120900600 GAGGAAAAAGAGCTGGAGCCGGG + Intronic
1090622951 11:128577664-128577686 GAGGCTGAAGACCAGGAGTCTGG - Intronic
1091205066 11:133815106-133815128 GATGATTAGGAGCAGGTGTGGGG + Intergenic
1091361381 11:134980995-134981017 GAGGGTCAGAAGCTGGAGTCTGG + Intergenic
1202815667 11_KI270721v1_random:45487-45509 GAGGTGAAGGTGCAGGGGTCAGG - Intergenic
1092166514 12:6346043-6346065 GAGGAGAAGGAGCTGGTGACAGG - Intergenic
1092763668 12:11832641-11832663 GAGGATGAGGAGCAGATGGCTGG - Intronic
1095267958 12:40181936-40181958 GAGGATAAGCAGGTGGATTCTGG - Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1096208315 12:49741922-49741944 GAGGAGAAGGAGCGGGAGAAAGG - Exonic
1096553213 12:52387939-52387961 GGTGAGAAGGAGTAGGAGTCTGG - Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1098024351 12:66186990-66187012 GAGGAGAAGGAATTGGAGTCGGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1099033615 12:77559564-77559586 GGGGATGGGGAGCAGGAGTGGGG + Intergenic
1099888126 12:88556668-88556690 GAGAAGAGGCAGCAGGAGTCTGG + Intronic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100795933 12:98181909-98181931 GAGGATGAGGAGAAGGCATCAGG + Intergenic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1102847675 12:116204720-116204742 TAGGATAAAGGGCAGGAGCCAGG - Intronic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103344782 12:120241964-120241986 GTGGATATGGAGAAGGAGTGAGG + Intronic
1103748235 12:123140734-123140756 GAGGTTAGAGAGCAGGAGTGGGG - Intronic
1103815089 12:123648782-123648804 GACAATAAGGAGCGGGATTCTGG - Intronic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1104836393 12:131794722-131794744 GTGGATAAGGCCCAGGTGTCAGG + Intronic
1104900843 12:132188857-132188879 GAGGAGCAGGAGCAGGAGGGAGG + Intergenic
1104915128 12:132260533-132260555 GGGGCTAAGGTGCAGAAGTCCGG - Intronic
1105782006 13:23714109-23714131 GAGGATGGTGAGCAGGAGTTGGG - Intergenic
1105804001 13:23939045-23939067 GAGGATGGTGAGCAGGAGTTGGG - Intergenic
1105891847 13:24687718-24687740 GTGGAAAAGGAGCAGGCGTAAGG + Intronic
1106279877 13:28257251-28257273 AGGGAGAAGGAACAGGAGTCAGG + Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107583890 13:41822949-41822971 GGGTAAAAGGGGCAGGAGTCGGG + Intronic
1109720244 13:66266957-66266979 GAGGAGACGGAGCATAAGTCAGG + Intergenic
1110561123 13:76911652-76911674 GGGTATATGGATCAGGAGTCCGG - Intergenic
1110758174 13:79200806-79200828 GAGGTGGAGGAGCAGGAGGCAGG - Intergenic
1113708302 13:112447906-112447928 GGGGCTGAGGAGCAGGAGTGGGG + Intergenic
1114401694 14:22416145-22416167 AAGGACAAGGAGCAGAAGACTGG + Intergenic
1114554105 14:23551649-23551671 GAGGAGGAGGAGGAGGAGGCAGG - Exonic
1114655639 14:24314029-24314051 GAGCATGAGGAGCAGGAGTGAGG - Exonic
1115399424 14:32939833-32939855 GAGGAGCAGGAGGAGGAGGCCGG + Intronic
1116037538 14:39645508-39645530 AAGGATAAGGAGGAGGAGTGGGG + Intergenic
1116394425 14:44430575-44430597 GTGGAGAAGGAGGAGGAGTGGGG - Intergenic
1116489971 14:45493611-45493633 GAAGATAAAGATCAGGAGTGGGG - Intergenic
1116876803 14:50120313-50120335 GAGGAAGAGGAGGAGGAATCAGG + Exonic
1117465176 14:55986148-55986170 GTGGAGAAGGTGCAGGAGCCAGG + Intergenic
1118318584 14:64740454-64740476 GAGGATGAGGACCAGGAATGTGG - Intronic
1118495834 14:66307433-66307455 GAGGAGAAGGGGCAGGAGATGGG + Intergenic
1118744358 14:68763138-68763160 AAGGAGAAGGGGGAGGAGTCTGG - Intergenic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1120219408 14:81715291-81715313 GAGGACAGGAAGCAGGAGTAAGG - Intergenic
1120691399 14:87597362-87597384 GGGGATATGGAACAGGAGGCAGG - Intergenic
1121033702 14:90681707-90681729 GAGAATGAGGAGCAAGATTCGGG + Intronic
1121186428 14:91975164-91975186 GAGGAGATGGAGCAGGTGACTGG - Exonic
1121433984 14:93906764-93906786 AAGGAAAAGGAGCCGGAGTCTGG + Intergenic
1122420348 14:101572516-101572538 GTGCATATGGAGCAGGAGCCTGG - Intergenic
1122420371 14:101572672-101572694 GTGCATATGGAGCAGGAGCCGGG - Intergenic
1122451077 14:101808094-101808116 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123166221 14:106327533-106327555 TAGGATATGGAGGAGGATTCTGG - Intergenic
1123168910 14:106352561-106352583 GAGGATATGGAGGAGGATTCTGG - Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123666848 15:22614794-22614816 GAGGAGGTGGAGCAGGAGTCGGG + Intergenic
1124320688 15:28709367-28709389 GAGGAGGTGGAGCAGGAGTCGGG + Intronic
1124481806 15:30085982-30086004 GAGGAGGTGGAGCAGGAGTGGGG - Intronic
1124488262 15:30138080-30138102 GAGGAGGTGGAGCAGGAGTGGGG - Intronic
1124521787 15:30411219-30411241 GAGGAGGTGGAGCAGGAGTGGGG + Intronic
1124536877 15:30555000-30555022 GAGGAGGTGGAGCAGGAGTGGGG - Intronic
1124543352 15:30607054-30607076 GAGGAGGTGGAGCAGGAGTGGGG - Intronic
1124563310 15:30794506-30794528 GAGGAGGTGGAGGAGGAGTCGGG - Intergenic
1124755265 15:32400240-32400262 GAGGAGGTGGAGCAGGAGTGGGG + Intronic
1124761773 15:32452591-32452613 GAGGAGGTGGAGCAGGAGTGGGG + Intronic
1124776854 15:32596477-32596499 GAGGAGGTGGAGCAGGAGTGGGG - Intronic
1125021765 15:34993194-34993216 GAGGAAGTGGGGCAGGAGTCGGG - Intergenic
1125511877 15:40296565-40296587 GAGGAAGAGGAGGAGGAGTCAGG - Exonic
1125679972 15:41524353-41524375 GAGGATGAGGAGGAAGAGTGGGG + Intronic
1125999430 15:44195194-44195216 GAGGATAAGGAGGAGGAACGAGG - Exonic
1126037820 15:44563853-44563875 GAGGAGAGGGTGCTGGAGTCTGG + Intronic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1127943014 15:63719849-63719871 GAGGGTAGGGAGCTGGAATCAGG + Intronic
1128304121 15:66586951-66586973 GAGGAGAAGGAGGAAGAGTGGGG - Intronic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1130274175 15:82468045-82468067 GTGGACAAGGGGCAGGAGTTTGG - Intergenic
1130466520 15:84195419-84195441 GTGGACAAGGGGCAGGAGTTTGG - Intergenic
1130497744 15:84478117-84478139 GTGGACAAGGGGCAGGAGTTTGG + Intergenic
1130588817 15:85200012-85200034 GTGGACAAGGGGCAGGAGTTTGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131171476 15:90181903-90181925 GAGGAGAAGGAGCAGGAAAAGGG + Intronic
1131224413 15:90612022-90612044 GAGGAGGAGGAGGAGGAGTGGGG - Intronic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131553098 15:93374740-93374762 GAGGATAAGGAGGCAGAGGCAGG + Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133690458 16:8209662-8209684 GAGGAAAAAGAGGAGGAGCCAGG + Intergenic
1133874744 16:9723201-9723223 GAGGAAGAGGAGGAGGAGACAGG + Intergenic
1134057162 16:11177781-11177803 GAGGAGGAGGAGGAGGAGACAGG + Intronic
1134657302 16:15956797-15956819 GAGGCTAAGGAGGAGGAGGAAGG + Intronic
1135014869 16:18916881-18916903 TAGGATAAGGAACAAGAGTCAGG + Intronic
1135221849 16:20621078-20621100 GAGGCTCAGGAGCAGGACTCTGG + Intronic
1136236891 16:28919850-28919872 GAGGAGAAGGAGCGGGAGCTGGG - Exonic
1136446602 16:30325597-30325619 TAGGATAAGGAACAAGAGCCAGG + Intergenic
1137246479 16:46710153-46710175 AAGGCTAAGGCCCAGGAGTCTGG - Intronic
1137543223 16:49378621-49378643 GAGATTATGGAGCAGGATTCTGG - Intronic
1137628830 16:49927835-49927857 GAGGGAAGGGAGGAGGAGTCGGG + Intergenic
1137978834 16:53053234-53053256 GAGGAGGAGGAGCAGGAGAAAGG - Intergenic
1138058796 16:53865372-53865394 GAGGATAAAAAGCAGAAGTGTGG - Intronic
1138421605 16:56902761-56902783 GAGGAGGAGGAGGAGGACTCCGG - Intronic
1138495956 16:57409609-57409631 GAGGAGAAGGAGACGGATTCAGG + Intronic
1138677881 16:58665243-58665265 CAGGAGAAGGAGCTGGAATCTGG - Exonic
1139573220 16:67826121-67826143 GGGGAGAGGGAGCTGGAGTCTGG - Intronic
1140192102 16:72826657-72826679 GAGGATCATTTGCAGGAGTCGGG + Intronic
1140514161 16:75530241-75530263 GATGATGAAGAGCAGGAGGCAGG + Exonic
1141404846 16:83783437-83783459 GAGGCTGAGGAGCAGGACTGAGG - Exonic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142667107 17:1469487-1469509 GAGGATGAGGAAGTGGAGTCAGG - Intronic
1143403432 17:6660410-6660432 GAGGCTAAGGTAGAGGAGTCAGG + Intergenic
1143409929 17:6702743-6702765 GAGGATAGGGAGCTGATGTCAGG - Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1145897643 17:28469744-28469766 TAGGGTAAGGAGGAGGAGTCAGG + Intronic
1146518460 17:33508070-33508092 GAGGAGAGGGAGGAGGAGTCAGG - Intronic
1146635264 17:34499433-34499455 GAGGATACAGACCAGGAGTCTGG + Intergenic
1146917610 17:36688066-36688088 GAGGTCCAGGTGCAGGAGTCAGG - Intergenic
1148511228 17:48171613-48171635 GAGGAAAAGGATTAGGATTCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148695932 17:49558281-49558303 GAGGAAAAGGGGCAGGAGCAGGG - Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149038389 17:52158932-52158954 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
1149576353 17:57716215-57716237 GGGGATAAGGAGCTGGAGGATGG - Intergenic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150964176 17:69948489-69948511 GAGGAGAAGGAGGAGGAGAGGGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152559808 17:81072291-81072313 GAGGTGAAGGAGCAGGAAGCCGG - Intronic
1154031353 18:10756625-10756647 GAGGATGAGGAGGAGGGGTGGGG + Intronic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1155829128 18:30490088-30490110 GAGAAGAAGAAGCTGGAGTCTGG - Intergenic
1156482660 18:37445881-37445903 GATGATAAGGAGGAGGAGGATGG - Intronic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157905158 18:51563236-51563258 GAGGGTAGGGAGAGGGAGTCCGG + Intergenic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158366284 18:56740722-56740744 GAAGATAAGAAGTAGGATTCAGG - Intronic
1158963469 18:62604811-62604833 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1159310258 18:66698457-66698479 GAGGAGAAGGAGGAGGAGAAAGG + Intergenic
1159402455 18:67955630-67955652 GGGGAGAAGGAGCAGGAGGGAGG + Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1160668713 19:345600-345622 GAGGATAGGAAGCAGGGGTGGGG + Intergenic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160975339 19:1790089-1790111 GAGGAGAAGGGGCAGGGGTGGGG - Intronic
1161021057 19:2011747-2011769 GAGGAGCAGGAGCAGGAGGGTGG - Intronic
1161079532 19:2303602-2303624 GAGGATATGGAGCAAGAGCATGG + Intronic
1161478957 19:4501244-4501266 GAGGACAAGGAGCACGAGGAGGG + Exonic
1161594370 19:5143750-5143772 GAGGCTGAGCAGCAGGAGGCTGG + Intronic
1161607600 19:5223302-5223324 GGGGATACGGGGCAGGTGTCAGG + Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162435250 19:10654342-10654364 GAAGAGGAGGAGGAGGAGTCCGG - Exonic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1163250066 19:16121509-16121531 GAGGAGAAGGCGCATGGGTCAGG + Intronic
1163574037 19:18099977-18099999 GAGGGCTAGGAGCAGGAGTGGGG + Intronic
1163779755 19:19240069-19240091 GAGGATGAGGAGCAGGAGGGAGG - Intronic
1164249930 19:23467535-23467557 GAGGAGAAGGAGGAGGAGTGGGG - Intergenic
1164324425 19:24179474-24179496 GAGGAAGAGGAGCAGGAGGATGG + Intergenic
1165326122 19:35115513-35115535 GAGGAGGAGGAGCAGGAGACAGG + Intergenic
1165361076 19:35337434-35337456 CAGGAGATGGAGCAGGACTCTGG + Intronic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166652131 19:44582648-44582670 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167354288 19:48993672-48993694 GAGCAAAAGGAGGAGGAGCCAGG + Exonic
1167384393 19:49155546-49155568 GAGGAGGAGGAGCAGGAGGCAGG - Intergenic
1167528711 19:50001542-50001564 GGGGGTAAGGAGCAGGAGGTGGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168238319 19:55077042-55077064 CAGGATGAGGAACAGGAGTTTGG + Intronic
1168265489 19:55221759-55221781 GATGATAAAGATCAGGAGACTGG + Intergenic
924960813 2:32916-32938 GAGGTTAGGGGGCAGGGGTCGGG - Intergenic
925169249 2:1740824-1740846 GAGAATGAGGAGCAGCTGTCTGG + Intronic
925273635 2:2633472-2633494 GAGGAGAAGGAACAGGAAACGGG - Intergenic
925365074 2:3305634-3305656 GAGGAGCAGGTGCAGGAGACGGG + Intronic
925781157 2:7382983-7383005 GAGGATAAGGCTCAGATGTCTGG + Intergenic
926215175 2:10901843-10901865 GAGGAGAAGGAGCGGGGGTGGGG + Intergenic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926520960 2:13912728-13912750 GAGGAGAAGGAGCTGGCATCAGG - Intergenic
928105430 2:28467795-28467817 GAGGCAAAGGAGCAGAAGCCAGG + Intronic
928325889 2:30319195-30319217 GAGGAGGAGGAGGAGGAGGCTGG + Intronic
928341093 2:30443793-30443815 GAGGCAAAAGACCAGGAGTCAGG + Intergenic
928432166 2:31229189-31229211 AAGGAGAAGGGGCAGGAGACAGG + Intronic
928653030 2:33421957-33421979 GTTGATAAGGAGCAGGAATGTGG - Intergenic
929055321 2:37871689-37871711 GAGGATAGGGAGTAGGCGTATGG + Intergenic
929072218 2:38043778-38043800 AAGGATAAGAAGGAGGAATCTGG - Intronic
931096574 2:58947381-58947403 GGGGAAAAGGAGCAGGAGAAAGG - Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931829753 2:66038532-66038554 GAGGATGAAGAGCAGCAGGCTGG - Intergenic
932270212 2:70402868-70402890 GGGGAGAAGGAGGAGGATTCAGG + Intergenic
932622043 2:73270537-73270559 GAGGATGTGGTGCAGAAGTCGGG - Intronic
934037450 2:88100022-88100044 TAGGAGAAGGAGCAGGAGGTGGG - Intronic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
936385779 2:112027768-112027790 GAAGATCAGGAGCAGGGGTGAGG - Intronic
937056356 2:118940630-118940652 GAGGACAAGCAGCAGAAGCCAGG - Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
938510033 2:131931687-131931709 GAGGTAAAGGAGCAAAAGTCAGG - Intergenic
940048696 2:149437731-149437753 CAGGCTCAGGAGCAGGAGCCAGG - Exonic
940259425 2:151764999-151765021 GAGGATGGGGAGCAGGAGGGAGG - Intergenic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
941800709 2:169656512-169656534 GAGGAGGAGGAGAAGGAGACAGG + Intronic
942419651 2:175794895-175794917 GAGAAAAAGGGGCAGGAGACAGG + Intergenic
944155266 2:196600947-196600969 GAGGAGAAGGAGAAGGAGAAGGG + Intergenic
945040353 2:205738771-205738793 GAGGAGAGGGAGCAGCAGGCTGG + Intronic
945225771 2:207530139-207530161 GAGGAGCAGGAGGAGGAGGCAGG + Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945764617 2:213959652-213959674 GAGGGTGAGGAGCAGGAGAGAGG - Intronic
945969510 2:216222037-216222059 GAGGCAAAAGAGGAGGAGTCTGG - Intergenic
946072828 2:217048968-217048990 GAGGAGGAGGAGCTGGAGTCAGG - Intergenic
946225457 2:218261928-218261950 GAGGAGAGGGAAGAGGAGTCTGG - Intronic
946402515 2:219475978-219476000 GAGGAGAAGTAGGATGAGTCAGG - Intronic
946851236 2:223909066-223909088 GAGGAGCAGGAGCAGGTTTCTGG - Intronic
946912394 2:224477209-224477231 GAGGATAGGGCCCAAGAGTCTGG - Intronic
946993640 2:225365159-225365181 GAGGAGAAGCAGCAGGGGTGAGG - Intergenic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
948939224 2:241187826-241187848 GAGGAGGAGGAGGAGGAGTTGGG + Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169561215 20:6802838-6802860 GAGGAGAAGGAGAAGGAGAACGG - Intergenic
1169907664 20:10619652-10619674 TAACATAAGGAGCATGAGTCAGG - Intronic
1170614444 20:17937611-17937633 AAGGAAATGGAGCAGGAGACTGG - Intergenic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1170916908 20:20635133-20635155 GAGGAGAATGAGGAGGAGCCAGG + Intronic
1173672669 20:44809613-44809635 GCGTATAAGAAGCAGGAGTCTGG + Intronic
1174002493 20:47385126-47385148 GAGGAGAAAGAGCAGGTATCTGG + Intergenic
1174287046 20:49481182-49481204 GAGGAGGAGGAGGAGGAGGCAGG - Intronic
1174881125 20:54280512-54280534 GTGGCCAGGGAGCAGGAGTCAGG + Intergenic
1175298837 20:57928590-57928612 GAGGAGAAGGAGGAGGAGAAGGG - Intergenic
1175675074 20:60939376-60939398 AAGGATAAGGAACTGGAGACGGG + Intergenic
1175725429 20:61315102-61315124 GAGCCCAAGGAGGAGGAGTCTGG - Intronic
1177833918 21:26170094-26170116 GGGGAGGAGGAGGAGGAGTCGGG - Intronic
1177981438 21:27920375-27920397 GAGGAAAAGGAGCAAAAGTCAGG + Intergenic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178671183 21:34592941-34592963 GAGGATGGGGAGCTGGACTCTGG + Intronic
1179570032 21:42273249-42273271 GTGGAGGAGGAGCAGGAGCCCGG + Intronic
1179799320 21:43803549-43803571 GAGGAAGAGGAGCAGGAGGAGGG + Exonic
1179898817 21:44378330-44378352 GAGGATCTGGAGCAAGAGTATGG + Intronic
1179928355 21:44550713-44550735 GAGGAAAAGCTGCAGGAGGCTGG + Exonic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180613026 22:17109662-17109684 GAGGAAGAGGAGCAGGACCCAGG + Exonic
1180874890 22:19170614-19170636 CAGGAACAGGAGAAGGAGTCAGG - Intergenic
1181408892 22:22704339-22704361 GAGGAGTGGGAGCAGGAGTGTGG - Intergenic
1182806159 22:33072282-33072304 GAGGAGAAGGAGGAGGAGGTGGG + Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183253736 22:36747431-36747453 GACATGAAGGAGCAGGAGTCAGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183547227 22:38460921-38460943 GAGGGTAAGGAGGAGGTGGCAGG + Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1183861281 22:40672045-40672067 GATTTTAAGGAGCAGGTGTCAGG - Intergenic
1184053524 22:42027241-42027263 CAGGATAAGGAGGACGACTCAGG + Exonic
1184212475 22:43044034-43044056 GAGGAGAAGGGGCAGTGGTCAGG - Intronic
1184244991 22:43231335-43231357 AAGGATAATGAGGAGGGGTCTGG - Intronic
1185399828 22:50610087-50610109 GAGGGTAAGGGACAGGAGTGTGG - Intronic
949459734 3:4277518-4277540 GAGGAAAAGAAGCAGGAGACAGG + Intronic
950101490 3:10359616-10359638 GAGGAGAAGGGGGAGGACTCTGG + Intronic
950401660 3:12773736-12773758 GAAGAAAAGGAGCAGGAGGAAGG + Intergenic
950774945 3:15341307-15341329 GTGGATGATGAGAAGGAGTCAGG - Intronic
951685897 3:25344052-25344074 TAGGCTAAGGATCAGGAGCCTGG + Intronic
951937844 3:28041726-28041748 CAGGATAAAGACTAGGAGTCTGG + Intergenic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
953350280 3:42210102-42210124 GAGGAGGAGGAGGAGGGGTCTGG + Intronic
953423683 3:42774484-42774506 CAGGATAAAGAGTAGGATTCAGG + Intronic
953636462 3:44669550-44669572 GAGGAAAAGGGGCGGGAGACAGG - Intergenic
953863359 3:46563922-46563944 GAGGTTCAGAAGCAGGAGACTGG - Intronic
954006432 3:47594936-47594958 GAGGAGTGGCAGCAGGAGTCAGG - Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
955147488 3:56334403-56334425 GAGGCTAAGTTGCAGGAATCAGG - Intronic
955283459 3:57616354-57616376 GAGGAGGAGGAGGAGGAGGCAGG + Intergenic
955444857 3:58998976-58998998 GAGGTTAATGTGCAGGAGTTTGG - Intronic
955448624 3:59042276-59042298 GAGGAAATGCAGCAGGAGACGGG + Intronic
955639859 3:61070611-61070633 GAAGAGAAGGAGCAGAAGGCAGG - Intronic
956065819 3:65396074-65396096 GAGGCTTAGGAGCAGGAGGATGG + Intronic
959939229 3:112062960-112062982 GGAGGTAAGGGGCAGGAGTCTGG + Intronic
961106849 3:124249831-124249853 GAGGTCAAAGAGCTGGAGTCGGG - Intronic
961641357 3:128366536-128366558 GAGGAGGAGGAGCAGGAGCTGGG + Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964718986 3:159753056-159753078 GAAGATGAGGAGCAGAAGTGGGG - Intronic
965151729 3:164986230-164986252 GAGAGTAAGGAGCAAGAGACAGG - Intronic
966149003 3:176845507-176845529 GAGGTCAAGGAGCAGGTGACTGG - Intergenic
967117176 3:186352570-186352592 GAGGAACAGGAGCAGGTGTGGGG - Intronic
967694878 3:192518883-192518905 GAAGAAGAGGAACAGGAGTCAGG - Intronic
967697128 3:192544970-192544992 GAGGAGATGGAGGAGAAGTCAGG + Intronic
967967455 3:194973441-194973463 GAGGTCCTGGAGCAGGAGTCTGG - Intergenic
968045683 3:195622746-195622768 GAGGATATGAAGCTGGAGACTGG - Intergenic
968064396 3:195750511-195750533 GAGGATATGAAGCTGGAGACTGG - Intronic
968308973 3:197667341-197667363 GAGGATATGAAGCTGGAGACTGG + Intergenic
968359923 3:198139670-198139692 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
968359929 3:198139690-198139712 GGGGAGAAGGAGGAGGAGTTGGG + Intergenic
968359935 3:198139710-198139732 GGGGAGAAGGAGGAGGAATCGGG + Intergenic
968889166 4:3358890-3358912 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
969365668 4:6692887-6692909 GAGGAGGAGGAGCTGGAGACAGG - Intergenic
971846838 4:31929266-31929288 GTGGATAGGGAGCAAGAGTGTGG - Intergenic
976085077 4:81399501-81399523 GAGGATAAGAATCTGGAATCTGG + Intergenic
976434208 4:84998368-84998390 GAGCATAAACAGCAGCAGTCAGG + Intergenic
977289862 4:95153351-95153373 GTGGAACAGGAGGAGGAGTCAGG - Intronic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979825925 4:125231935-125231957 GAGGAAAAGGGTCAAGAGTCAGG + Intergenic
980931769 4:139189003-139189025 GAGGAGGAGGAGGAGGAGGCTGG - Intergenic
980969591 4:139556245-139556267 GAGGAAGAGGAGGAGCAGTCGGG + Exonic
981025047 4:140069453-140069475 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981025062 4:140069514-140069536 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
981857118 4:149307909-149307931 GAGAATGAGGAGCAAGATTCTGG - Intergenic
982123363 4:152162888-152162910 GAGGATAAGGAAGAGGAGAAAGG + Intergenic
982587502 4:157260880-157260902 GAAGAAAAGGAGCAGGAATGAGG - Intronic
983039715 4:162911000-162911022 GAGGAAGAGGAGGAGGAGTAGGG - Intergenic
983577026 4:169271061-169271083 GAGGAAGAGGAGGAGGAGGCCGG + Exonic
983608887 4:169620561-169620583 GAAGAGAAGCGGCAGGAGTCAGG - Exonic
983720456 4:170845250-170845272 GAAGAGAAGGAGAAGGTGTCAGG + Intergenic
983873930 4:172854118-172854140 GAGGAAAAGGAGAAGCATTCTGG - Intronic
984847468 4:184120188-184120210 GGGAAGAAGGAGCAGGAATCAGG - Intronic
984873061 4:184344384-184344406 GAGGATAAGAGGCAGGAGACCGG - Intergenic
986700621 5:10404732-10404754 GAGGAAGAGGAGGAGGGGTCAGG + Intronic
988257304 5:28837082-28837104 GAGTCTAAGGAACAGAAGTCTGG - Intergenic
989785930 5:45329457-45329479 AAGGAAAAGGCACAGGAGTCTGG + Intronic
990602187 5:57370366-57370388 GAATTTAATGAGCAGGAGTCAGG - Intergenic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992551757 5:77866253-77866275 CAGGAGACGGAGCAGGAGTGGGG + Intronic
992753945 5:79886736-79886758 GAGGATGAGGAGAAGAAATCTGG - Intergenic
993501013 5:88666965-88666987 AAGGATCAGGACCTGGAGTCTGG - Intergenic
995354900 5:111225683-111225705 GAGGATCCAGAGCAGGATTCTGG + Intronic
997014500 5:129916787-129916809 GTGCATAAGAAGGAGGAGTCAGG + Intronic
997032230 5:130144265-130144287 GGGGATAAGTAGCAGGAAACTGG - Intronic
997356708 5:133267191-133267213 GAGGAGGAGGTGCAGGATTCTGG + Intronic
997388932 5:133497522-133497544 GAGGATAAGGAACAAGCCTCAGG - Intronic
997618599 5:135270462-135270484 GAGGACCTGGAGCAGGGGTCTGG + Intronic
998164334 5:139834240-139834262 GAGGAAAAGGAGCAGGTTTTTGG + Intronic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998570499 5:143252460-143252482 GAAGATAAGCGGCAGGAATCTGG - Intergenic
998781382 5:145660419-145660441 GAGGGTTAGGAGGAGGAGCCAGG - Intronic
1000201538 5:159015609-159015631 GAAGTTAAGGAGCAGAGGTCTGG - Intronic
1000600675 5:163271261-163271283 GAGGATATGGAGTAAGAGTTTGG - Intergenic
1002521550 5:179795555-179795577 GAGGAGGGGGAGCGGGAGTCAGG - Intronic
1003139250 6:3457087-3457109 GAGGAGGAGGAGGAGGAGTGGGG - Intergenic
1003490203 6:6614602-6614624 GAGGATGGGGAGCATGAGACAGG - Intronic
1004004109 6:11623276-11623298 GGGGCTGAGGGGCAGGAGTCTGG - Intergenic
1004831205 6:19478338-19478360 GAGGATATGGAGCAGAAGTGAGG + Intergenic
1004993763 6:21168231-21168253 GAGGAGGAGGAGCAGAAGGCTGG - Intronic
1005803092 6:29446525-29446547 GCAGAGAAGCAGCAGGAGTCAGG + Intronic
1005883016 6:30074714-30074736 GAGGAGCGGGAGCAGGAGGCTGG - Intronic
1005954335 6:30653200-30653222 AAGGAAAAGGAGCTGGTGTCAGG + Exonic
1006043603 6:31274289-31274311 GAGGACAAGGAGCAGGGGAAAGG - Intronic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006689591 6:35870382-35870404 GAGGAAATGGAGAAAGAGTCGGG - Exonic
1006963438 6:37957810-37957832 GAGGAAAAGCAGCAGGACCCTGG + Intronic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008043650 6:46829614-46829636 GAGGAGAAGAAGCAGGATCCCGG - Intronic
1008402386 6:51078674-51078696 GAGGATCAGGAGTAAGATTCAGG - Intergenic
1008968902 6:57343881-57343903 GGGGATTTGGAGCAGGGGTCAGG + Intronic
1009157885 6:60245692-60245714 GGGGATTTGGAGCAGGGGTCAGG + Intergenic
1009589760 6:65652400-65652422 GAGGATAGGGAGGAGGAGACAGG + Intronic
1009897619 6:69772648-69772670 GGGGAAAAGGGGCAGGAGACAGG + Intronic
1009973608 6:70650793-70650815 CAGGATAAAGCACAGGAGTCTGG + Intergenic
1010745820 6:79560379-79560401 AAAGATAACTAGCAGGAGTCAGG + Intergenic
1011398737 6:86937464-86937486 GAGGAGCAGGAGCAGGAGCATGG - Exonic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013745251 6:113337670-113337692 GAGAATATTAAGCAGGAGTCAGG - Intergenic
1016003685 6:139067771-139067793 GAGGAGAAGGAGGAGGAGAGGGG - Intergenic
1016813570 6:148283331-148283353 GAAGGTATGTAGCAGGAGTCTGG - Intronic
1017068248 6:150549660-150549682 GAGGAACAGGAGGAGGACTCGGG - Intergenic
1018038028 6:159898485-159898507 GAGGAGGAGGAGGAGGAGTCTGG - Intergenic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019078019 6:169406519-169406541 GCGGATTAGGAGCGAGAGTCTGG - Intergenic
1019260054 7:76932-76954 GGGGAGAAGGAGGAGGAATCGGG - Intergenic
1019260060 7:76952-76974 GAGGTGAAGGAGGAGGAGTCGGG - Intergenic
1019701873 7:2478030-2478052 GAGGACACAGAGCAGGACTCTGG + Intergenic
1020086408 7:5313035-5313057 GAGGAGGAGGAGGAGGAGGCCGG + Exonic
1021850292 7:24801401-24801423 GAGGAGAAGAATCAGGAGGCTGG - Intronic
1024304344 7:47914635-47914657 GAGGTTGAGGATCAGGATTCTGG - Intronic
1025664037 7:63572796-63572818 GAGGAGGAGGAGGAGGAGGCCGG + Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1027043536 7:74976527-74976549 GAGGAGGAGGAGGAGGAGACAGG - Intronic
1027080110 7:75225832-75225854 GAGGAGGAGGAGGAGGAGACAGG + Intergenic
1027171765 7:75877952-75877974 GAAGAAAAGGGGCAGGAGGCTGG - Intronic
1027487853 7:78784353-78784375 GAGAATGAGGAGCAAGAGACAGG - Intronic
1027835011 7:83230293-83230315 GTAGAGAAGGAGCTGGAGTCAGG + Intergenic
1028152597 7:87391312-87391334 GAGCATAAATAGCAGGAGGCAGG + Intronic
1029379549 7:100204094-100204116 GAGGCTCAGCAGCAGGATTCGGG - Exonic
1029495546 7:100894167-100894189 GAGGAGGAGGAGAAGGAGTGGGG + Exonic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1029984994 7:104914830-104914852 GAGGAGAAGAAGCAGGGGTTTGG + Intergenic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030320750 7:108164573-108164595 GAGGAGCAGGAGCAGGAGCAGGG + Intronic
1030583075 7:111384174-111384196 GAGGAGAAGGAGAAGGAGAAAGG + Intronic
1030978918 7:116162997-116163019 GATGAGAAGGATCAGGAATCAGG + Intergenic
1033317316 7:140308271-140308293 GAGGAGAAGGAGCTGGACTTTGG - Intronic
1033653594 7:143359675-143359697 GAAGATGAGGAGGAGGAGTTCGG + Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1035261797 7:157666603-157666625 GAGGCTGAGGACCAGGACTCTGG + Intronic
1037300247 8:17443993-17444015 GAGGGAAAGGAGGAGGAGTGAGG - Intergenic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1040522910 8:48193234-48193256 GAGGAGGAGGAGCAGGAGCTGGG + Intergenic
1041762817 8:61385086-61385108 GAGGAAAGGGAGCAGGAGCATGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042738919 8:72021014-72021036 TAGGAGAAGGAGCAGAAGTGAGG + Intronic
1043662039 8:82755629-82755651 GAGGAGAAGAAGCAAGTGTCTGG - Intergenic
1044458975 8:92422649-92422671 GAGCATGAGGATCAGGAGACTGG - Intergenic
1044540160 8:93399606-93399628 GGGGATAAGGAGCAGTAGAAGGG + Intergenic
1044857712 8:96493716-96493738 GAGGAGAAGGAGGAGGACCCGGG + Exonic
1045184511 8:99823449-99823471 GAGGAGGAGGAGGAGGAGTGAGG + Intronic
1046768738 8:118098013-118098035 GGGGAGAAGGAGGAGGAGTGTGG + Intronic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047591167 8:126329168-126329190 GAAGCTCAGCAGCAGGAGTCAGG - Intergenic
1047817609 8:128482036-128482058 GAGGAGCATGAGCAGGAGACTGG - Intergenic
1048267352 8:132999179-132999201 GAGAAGGACGAGCAGGAGTCTGG + Intronic
1048865294 8:138756356-138756378 GAGGCCAAGGAGGAGGAGGCAGG - Intronic
1049405253 8:142449533-142449555 GAGGAGAAGGAGGAGGAGAGAGG - Exonic
1050125043 9:2348016-2348038 CAGGAGAAGGAGCAAGAGTGGGG - Intergenic
1050923363 9:11233941-11233963 GTGGAGAAGGAGGAGGAGTGGGG + Intergenic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053887946 9:42658526-42658548 GAGGATAGGGGTCAGGGGTCAGG + Intergenic
1054226967 9:62465976-62465998 GAGGATAGGGGTCAGGGGTCAGG + Intergenic
1055205843 9:73729179-73729201 GAGGCTAAGGAGGAGGAATGGGG - Intergenic
1055232009 9:74077583-74077605 AAGGAAAATCAGCAGGAGTCTGG + Intergenic
1055379034 9:75685980-75686002 GAGGAGGAGGAGAAGGAGTTGGG + Intergenic
1055384019 9:75741661-75741683 GAGGTTAAGGAGTGGGAGTGAGG - Intergenic
1055781123 9:79822812-79822834 GAGGAGAAGTTTCAGGAGTCGGG + Intergenic
1056452928 9:86734160-86734182 GAGGAGGAGAAGCAGGCGTCTGG + Intergenic
1056941509 9:90960425-90960447 GAGGAGCAGGACCATGAGTCAGG + Intergenic
1056963665 9:91148391-91148413 GAGGATCAGGAGGAGCAGTCGGG + Intergenic
1057075305 9:92135399-92135421 GAAGATAAGGAGCAGCAGCAGGG + Intergenic
1057113914 9:92502063-92502085 GATGATGAGGAGAAGGAGTATGG + Intronic
1058307294 9:103459849-103459871 GAGGAAAGGGGGCTGGAGTCAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058745529 9:107986812-107986834 GAGGATGAGGCGGAGGAGGCTGG + Intergenic
1059296785 9:113277760-113277782 GAGGCTGAGAAGCGGGAGTCTGG + Intronic
1059534935 9:115071711-115071733 GAGGAAGAAGAGCAGGAGTGAGG + Intronic
1059585662 9:115603366-115603388 GAGGACCAGGTGCAGAAGTCAGG + Intergenic
1059634506 9:116157866-116157888 GGGGATGAGGAACAGGGGTCTGG - Intronic
1059796713 9:117705458-117705480 GAGGACAAGGAGGAGGACTATGG - Intronic
1060237256 9:121873611-121873633 GAGGAGGAGGAGGAGGAGGCGGG - Intronic
1061629637 9:131863959-131863981 GAGGATAAGGAGCTGGATCCAGG - Intronic
1061759967 9:132843791-132843813 GTGGCTAAGGAACAGGAGTGAGG + Intronic
1061807343 9:133143923-133143945 GGGGCTGAGGAGCAGGGGTCAGG - Intronic
1062249432 9:135586938-135586960 GAGGACAAGGGGCAGGACTGAGG - Intergenic
1062348644 9:136127873-136127895 GAGGAGGAGGAGGAGGAGGCTGG + Intergenic
1062675182 9:137738863-137738885 GAGTAGAAGGGGCTGGAGTCTGG + Intronic
1062744627 9:138203490-138203512 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
1062744633 9:138203510-138203532 GGGGAGAAGGAGGAGGAGTCGGG + Intergenic
1062744639 9:138203530-138203552 GGGGAGAAGGAGGAGGAATCGGG + Intergenic
1203772640 EBV:57466-57488 GAGGAAGAGGAGAAGGAGCCCGG + Intergenic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185591607 X:1281052-1281074 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1185591619 X:1281096-1281118 GAGGAGAAGGAGGAGGAGAAGGG - Intronic
1186730227 X:12402117-12402139 GAGGAGAAGGAGGAAGAGACTGG + Intronic
1187847193 X:23552432-23552454 GAGGATATAGACCAGCAGTCTGG + Intergenic
1188213948 X:27455151-27455173 GAGGAGTAGGAGCAGAAGTGGGG - Intergenic
1188539641 X:31235125-31235147 TAGGAGAAGGTTCAGGAGTCTGG + Intronic
1189242395 X:39535422-39535444 GATGAGAAGGAGCAGGAGCTGGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189684344 X:43548420-43548442 GGGGGTAAAGAGGAGGAGTCAGG + Intergenic
1190110795 X:47587761-47587783 GAGTATGAGGGGCAGGAGCCAGG - Intronic
1190229854 X:48573937-48573959 GAGGAGAAAGAGTAGGAGTCAGG + Intergenic
1192235288 X:69291688-69291710 GGGGAGAAGGAGGAGGAATCAGG + Intergenic
1192448076 X:71225044-71225066 AAGGAAAAGGAGGAGGTGTCTGG + Exonic
1192573066 X:72222061-72222083 GTGGAGAAGGAGGAGGAGTGGGG - Intronic
1193366300 X:80637811-80637833 GAAGATGACGAACAGGAGTCAGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194763758 X:97825280-97825302 GAGGAAAAGGAGCAGGTCTGAGG + Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1198092226 X:133342715-133342737 GAGGAAAAGGAGGACAAGTCTGG + Intronic
1198957477 X:142148583-142148605 GAGGAGGAGGAGCAGGAGCTTGG + Intergenic
1199863743 X:151824684-151824706 AAGGAAGAGGAGCAGGACTCAGG + Intergenic
1199901535 X:152177361-152177383 GAGGATAAGGATAAGAAGTGAGG + Intronic
1199977013 X:152900125-152900147 GAAGACAAGGAGCACAAGTCAGG - Intergenic
1200142319 X:153908328-153908350 GAGGAGCAGGAGCGGGAGCCAGG - Intronic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic