ID: 947435283

View in Genome Browser
Species Human (GRCh38)
Location 2:230067925-230067947
Sequence CACCGAGCGCGGGTGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947435283_947435300 20 Left 947435283 2:230067925-230067947 CCCGCCCCCACCCGCGCTCGGTG 0: 1
1: 0
2: 2
3: 24
4: 244
Right 947435300 2:230067968-230067990 CGAGACCACATCCCCACTTCGGG 0: 1
1: 0
2: 1
3: 14
4: 92
947435283_947435299 19 Left 947435283 2:230067925-230067947 CCCGCCCCCACCCGCGCTCGGTG 0: 1
1: 0
2: 2
3: 24
4: 244
Right 947435299 2:230067967-230067989 CCGAGACCACATCCCCACTTCGG 0: 1
1: 0
2: 0
3: 5
4: 111
947435283_947435291 -8 Left 947435283 2:230067925-230067947 CCCGCCCCCACCCGCGCTCGGTG 0: 1
1: 0
2: 2
3: 24
4: 244
Right 947435291 2:230067940-230067962 GCTCGGTGCTCCCGCTCCCTTGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947435283 Original CRISPR CACCGAGCGCGGGTGGGGGC GGG (reversed) Intronic
900427097 1:2585840-2585862 CACCGAGTTGGGGTGAGGGCCGG - Intergenic
900562828 1:3316135-3316157 GACTGAGGGCGGGTGGGGGCGGG + Intronic
900598167 1:3491762-3491784 CACGGTGCGGGGGTGGGGGGGGG + Intronic
900698452 1:4027653-4027675 CACCGTGGGAGGGTGGGGGCGGG + Intergenic
900700680 1:4047002-4047024 CACCCAGCCCTGGTGGGGGCAGG - Intergenic
901018822 1:6245817-6245839 AACCGGGCGGGGGTGGGGGCGGG - Intergenic
901086623 1:6614894-6614916 GACCGCGGGCGGGTGGGGGAGGG + Intronic
901640881 1:10692452-10692474 CACCGACTGGAGGTGGGGGCAGG + Intronic
901696545 1:11012297-11012319 CAGCGAGGGCGGGGCGGGGCGGG - Intergenic
902541882 1:17161677-17161699 CACCTAGGGTGGGTGCGGGCAGG - Intergenic
903012892 1:20343464-20343486 CACCGGGGGCGGGTGGGGAAGGG - Intronic
903597131 1:24503156-24503178 CACCCAGCGCGGGGCGGGGCGGG + Intronic
905137162 1:35808441-35808463 GAGCGAGCTCGGGTCGGGGCGGG + Intronic
905793455 1:40802446-40802468 CCCCGAGAGCGGGAGGGGCCGGG - Intronic
909160216 1:72137576-72137598 CACAGACTGGGGGTGGGGGCTGG + Intronic
915601141 1:156924042-156924064 GACGAAGGGCGGGTGGGGGCGGG - Exonic
916605926 1:166342955-166342977 CACCGCTCGGGGGTGGGGGGTGG + Intergenic
920080305 1:203368264-203368286 CAAGGCGCGGGGGTGGGGGCGGG + Intergenic
920237262 1:204516459-204516481 CGCCGAGCCCGGGTGGGGGGAGG - Exonic
920397808 1:205659512-205659534 CGCAGAGCGCGGGTGGAGGTGGG + Exonic
923669243 1:236025975-236025997 CACCGAGAGCTGCTGGGTGCTGG + Exonic
1064275830 10:13904096-13904118 CACCAGGCACTGGTGGGGGCTGG + Intronic
1064384758 10:14879607-14879629 CACCGAGCGCGCGTGGGTGTGGG + Intronic
1065099624 10:22320921-22320943 CGCGGAGCGAGGGAGGGGGCCGG + Intronic
1067369838 10:45672846-45672868 CAATCAGCGCGGGCGGGGGCAGG + Intergenic
1067769812 10:49115310-49115332 CTCCGGGCGCGGGCGGGGGGCGG - Intronic
1068584637 10:58783190-58783212 CACCAGGAGAGGGTGGGGGCTGG + Intronic
1069158094 10:65054062-65054084 CACGGAGCGCGGGTAGCAGCCGG - Intergenic
1069640026 10:69948819-69948841 GACAGAGGGAGGGTGGGGGCTGG + Intronic
1070570657 10:77637758-77637780 CGCGGAGCGCGGGAGGGGGGCGG + Intronic
1071747557 10:88438962-88438984 CACCGGGGGCGGGTGGGAGTGGG + Intronic
1072784165 10:98268805-98268827 CACGGAGGGCGGGGGGGGGGGGG - Intergenic
1073759243 10:106612394-106612416 CACGCTGCGGGGGTGGGGGCGGG - Intronic
1074585980 10:114768163-114768185 CACCGGGAGCCGGAGGGGGCCGG - Intergenic
1075112294 10:119597000-119597022 GTCCCAGCGCGGGTGGGCGCCGG - Intronic
1075801848 10:125159410-125159432 CGGCGGGCGCGGGCGGGGGCCGG - Intronic
1076680806 10:132170280-132170302 CCCCGAGGGCGGCTGGGGACAGG + Intronic
1076723447 10:132402709-132402731 CCCTGGGCGGGGGTGGGGGCTGG + Intronic
1076917740 10:133432960-133432982 CCCCGAGCGCCGGTGAGGGAGGG - Intergenic
1077008133 11:368888-368910 CACCGAGCGCGGCCTGAGGCAGG - Intergenic
1077014628 11:394129-394151 CCCTGAGCGCAGCTGGGGGCGGG - Intronic
1077063313 11:627021-627043 CACTGGGGGCGGGTGGGGCCCGG + Intronic
1077115559 11:883089-883111 CACTGGGCGCGGGTGGGTGTGGG - Intronic
1077174390 11:1182022-1182044 CAGGGACCGCGGGTGGGGACAGG + Intronic
1077331501 11:1985812-1985834 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1077504245 11:2922772-2922794 CACCTAGCCCAGCTGGGGGCAGG + Intronic
1077923111 11:6655899-6655921 CGCGGAGCGCGGGTGGGGGCGGG - Intergenic
1078316086 11:10294252-10294274 GAGCCAGCGCGGGTGGGGGCGGG - Intergenic
1078660098 11:13278717-13278739 CCCGGAGCCCGGGTGCGGGCCGG + Intronic
1081763242 11:45591655-45591677 CACCTAGAGAGGGTGGGGTCTGG + Intergenic
1081854547 11:46295425-46295447 CTCCCTGCGGGGGTGGGGGCGGG + Intronic
1084068693 11:66720197-66720219 CTCCGAGTGGGGGTGGGGGTTGG - Intronic
1084608871 11:70188078-70188100 CACCGGGCCCTGGTGGGAGCGGG - Exonic
1084786957 11:71448183-71448205 CACAGGGCGAGGGTGGGGTCAGG - Intronic
1085297616 11:75439807-75439829 CACCTGGCTGGGGTGGGGGCTGG + Intronic
1089584616 11:119502505-119502527 CACAGAGCGCGGGGTGGGGTGGG - Intergenic
1090367904 11:126223152-126223174 CAGCGAGTGAGGGAGGGGGCTGG + Intronic
1090396812 11:126424553-126424575 CACACACCGCGGGTGGGGACGGG - Exonic
1091259689 11:134224652-134224674 CTCCGGGCGGGGGAGGGGGCGGG - Exonic
1091286745 11:134412258-134412280 GGCGGAGAGCGGGTGGGGGCGGG - Intergenic
1202814482 11_KI270721v1_random:40988-41010 GACCCAGGGCAGGTGGGGGCTGG + Intergenic
1091603022 12:1929444-1929466 CACCATGCATGGGTGGGGGCCGG + Intergenic
1093921588 12:24865923-24865945 CACCGAGAGCGAGTGAGGGCTGG - Intronic
1098426112 12:70366680-70366702 CGCCGGGGGCGGGAGGGGGCGGG + Exonic
1098801217 12:74960588-74960610 CACAGAGTCGGGGTGGGGGCAGG + Intergenic
1099317816 12:81106527-81106549 CACCGAACTGGGGTGGGGGAAGG - Intronic
1099758832 12:86892715-86892737 CACAGAGCCCAGGTCGGGGCAGG - Intergenic
1102258157 12:111428163-111428185 CACCGAGGCCTGGAGGGGGCTGG + Intronic
1102856758 12:116300801-116300823 CACCAAGCGGGGGTCGGGGTGGG + Intergenic
1103443517 12:120979941-120979963 CACCTAGTGGGGGTGGGGGATGG + Intronic
1104686574 12:130788784-130788806 CAGGGAGCGCGGGCAGGGGCGGG + Intergenic
1106539099 13:30674226-30674248 CCCGGCGCGCGGGAGGGGGCGGG + Intergenic
1107886815 13:44880654-44880676 CACCTGGCGGGGGTGGGGGGGGG - Intergenic
1113475252 13:110576025-110576047 CCCCCAGAGCGGGTGGGGGATGG - Intergenic
1113841540 13:113364136-113364158 GACCGCGGGCGCGTGGGGGCGGG + Exonic
1113868316 13:113543308-113543330 CACAGAGGGAGGGCGGGGGCAGG - Intronic
1113937972 13:114005294-114005316 CCCCGAGCGGGAGTGGGAGCCGG + Intronic
1114338662 14:21719928-21719950 GACAGGGCGGGGGTGGGGGCGGG - Intergenic
1114654427 14:24307650-24307672 CATGGAGTGCAGGTGGGGGCGGG + Exonic
1118206510 14:63728122-63728144 CAGGGAGCCCGGGTGGGGGCGGG - Intergenic
1118992605 14:70809617-70809639 CAGCGGGCGCGGGGCGGGGCGGG - Intergenic
1120809970 14:88792996-88793018 GAGTGAGCGCGGGAGGGGGCGGG - Intergenic
1121573399 14:94964301-94964323 CACCTGGCTGGGGTGGGGGCAGG - Intergenic
1121711016 14:96039312-96039334 CCCCGAGCGCGGGGGCGGGCGGG - Exonic
1122263952 14:100538188-100538210 CACCCAGCGAGGGGGGGGACGGG - Exonic
1122904534 14:104795715-104795737 GACCGAGCGCGGCAGGCGGCTGG - Intronic
1123696221 15:22880834-22880856 CACTTGGCGGGGGTGGGGGCGGG + Intronic
1124656268 15:31510304-31510326 CACAGAGCTCGGGTGGGGAGAGG + Intronic
1128097178 15:64965988-64966010 CACCAAGCCCGGCTGGGGTCGGG + Intronic
1131250726 15:90828354-90828376 GACCGTGCGTGGATGGGGGCGGG + Intergenic
1131259220 15:90879973-90879995 CACCGAGCCCAAGTGAGGGCTGG + Exonic
1132578699 16:675512-675534 GCCAGAGCGGGGGTGGGGGCCGG + Intronic
1133188344 16:4116031-4116053 CCCGGAGCGCGGGGGGCGGCCGG - Exonic
1134321903 16:13171480-13171502 CAGGGGGCGGGGGTGGGGGCGGG + Intronic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136687537 16:32003992-32004014 CACAGGGCGCGGGGGGCGGCAGG - Intergenic
1138178595 16:54928374-54928396 CACGGGGCGGGGGCGGGGGCGGG + Intergenic
1140478543 16:75250840-75250862 CGCCGAGCGCCGGTGGAAGCCGG - Intronic
1141722669 16:85765558-85765580 CACCGTGCCTGGGTGGGGGTGGG + Intergenic
1142718751 17:1762694-1762716 CAAAGAGAGTGGGTGGGGGCTGG - Intronic
1143116568 17:4584763-4584785 CACCGTGCGCGCCAGGGGGCCGG - Exonic
1143496430 17:7315249-7315271 CACCGCGCGCGGGCGGCGCCGGG + Intronic
1144606153 17:16667084-16667106 CACGGAGCGCGGGTAGCAGCCGG + Intergenic
1145980116 17:29006063-29006085 CGCCGAGCGGGGCTGGGGGCGGG + Exonic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1147110366 17:38257154-38257176 CACCGAGCGCGGGCGACCGCCGG + Intergenic
1147148517 17:38499661-38499683 CACAGGGCGCGGGGGGCGGCGGG - Intronic
1147629125 17:41918776-41918798 CACCGAGCCCGCGTCGGGGAAGG + Intronic
1147636484 17:41967263-41967285 CCCCGCGCCCGGGTGCGGGCGGG + Intronic
1148157636 17:45432699-45432721 CGCCGAGCGGGGGTTGGGGGTGG - Intronic
1148419144 17:47531277-47531299 CACCGAGCGCGGGCGACCGCCGG - Exonic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148871192 17:50659548-50659570 CTCCCAGCTCTGGTGGGGGCAGG + Intronic
1150894557 17:69196079-69196101 CTCCCAGAGCGGGTGGCGGCTGG + Intronic
1151758148 17:76086425-76086447 CACCCAGGGTGGGTGGGGGCAGG - Intronic
1152349693 17:79777926-79777948 CCCCGGGCGGGGGCGGGGGCGGG - Intergenic
1152860925 17:82696964-82696986 CACCGAGCGGGGAGGGGGGTAGG + Intronic
1153290691 18:3499076-3499098 CACCGAGCTCGGGAGCGGACGGG + Exonic
1153931823 18:9885858-9885880 CACAAAGCTAGGGTGGGGGCAGG - Intronic
1156236023 18:35205937-35205959 CACCGTGCGCGAGCTGGGGCAGG + Intergenic
1157674979 18:49562133-49562155 CACGGAGCCCGGGCGGTGGCAGG - Exonic
1160609259 18:80073190-80073212 CAACGAGCTCTGGTGGGGGGTGG - Intronic
1160631216 18:80247437-80247459 AAGCGAGCGCGGGCCGGGGCCGG - Exonic
1160990155 19:1857128-1857150 CTCCAAGCGCGGGGCGGGGCTGG - Intronic
1161026656 19:2040181-2040203 CAACGAGAGTGGGCGGGGGCAGG + Intronic
1161150104 19:2702870-2702892 CTCCGGGCGCGGGCGGGGCCGGG + Intergenic
1162030814 19:7916560-7916582 CACCAGGGGCGGATGGGGGCCGG + Intronic
1162435301 19:10654533-10654555 CACTGAGGGCGGGCGGGGGGAGG - Intronic
1162808191 19:13149913-13149935 CGGCGGGCGCGGCTGGGGGCAGG + Intronic
1163720431 19:18895940-18895962 CACGGACTGCGGCTGGGGGCTGG - Exonic
1164155749 19:22596046-22596068 CTCCGGGAGCGGGCGGGGGCGGG - Intergenic
1165479495 19:36054288-36054310 CGGCGAGCGCGGGTGGGGCGGGG - Exonic
1166109701 19:40614452-40614474 TAGCGAAGGCGGGTGGGGGCAGG - Intronic
1166198007 19:41219339-41219361 CTCCCAGCGGGGGAGGGGGCAGG - Exonic
1166352890 19:42208676-42208698 CACCAAGAGAGGGTGGGAGCAGG - Intronic
1167074262 19:47239532-47239554 GACCGGGGCCGGGTGGGGGCTGG + Intergenic
1167410107 19:49339424-49339446 GGCCGATCGCGGGTGGGGGCGGG - Intronic
1167596741 19:50432162-50432184 CACCGGACGCGGGTAGGGGGTGG - Intergenic
1168126346 19:54285681-54285703 CACGGTGTTCGGGTGGGGGCAGG - Intergenic
1168175546 19:54625183-54625205 CACGGTGTTCGGGTGGGGGCAGG + Intronic
927258244 2:21059690-21059712 CACCTAGAGAGGGTTGGGGCAGG - Intergenic
928091038 2:28375325-28375347 CACCCAGCCCGGCAGGGGGCAGG + Intergenic
929534408 2:42771619-42771641 CACTGAGCCAGGCTGGGGGCTGG - Intronic
930027809 2:47040086-47040108 CACCGAGCCTGGGTGAGGGGTGG + Intronic
930800948 2:55442263-55442285 CACCGTGCGCGAGTCGGAGCGGG + Intergenic
932495709 2:72144849-72144871 ACCCGAGCGCGGGGCGGGGCGGG + Intronic
932791009 2:74654474-74654496 CACCGAGCGGGGGACGCGGCCGG - Exonic
934237676 2:90245884-90245906 CACCGGGCGGGGGGGGGGGGTGG + Intergenic
934500621 2:94857797-94857819 CAGTGAGGGCGGGTGGGGGAAGG - Intergenic
935332934 2:101990360-101990382 CACAGAGCGAGGGTGGAGACAGG + Intergenic
935888398 2:107649019-107649041 GACAGAGCACGGGTGAGGGCAGG - Intergenic
938093550 2:128447980-128448002 CACAGAGCTATGGTGGGGGCAGG + Intergenic
938265203 2:129923360-129923382 CAGCGACCGGGTGTGGGGGCGGG + Intergenic
938324934 2:130391833-130391855 GACCGAGCGCGGGGAGGGGCAGG + Intergenic
944715979 2:202376443-202376465 GACCGAGGGCGGGGGGCGGCGGG - Intergenic
946328332 2:218996380-218996402 CACCGAGCGGGGCTGGGGGCTGG + Intergenic
946747442 2:222860765-222860787 GACGGACCGCGGGTGGGGGAGGG - Intergenic
947435283 2:230067925-230067947 CACCGAGCGCGGGTGGGGGCGGG - Intronic
948607939 2:239147680-239147702 CACCAAGCGTGGGTGAGGGCAGG + Intronic
1172095292 20:32457383-32457405 CACCCAGAGTGGGTGGGGGAGGG + Intronic
1172425414 20:34852323-34852345 AACCAAGAGGGGGTGGGGGCTGG - Intronic
1174804545 20:53594064-53594086 CTCCGGGCGGGGGTGGGGGTGGG - Intronic
1176119277 20:63446719-63446741 CCCCGAGGGAGGGCGGGGGCTGG - Intronic
1176131638 20:63498935-63498957 CTCCGGGCGCGCGCGGGGGCGGG + Intronic
1178075860 21:29012246-29012268 CACCCAGACCGGGTGGTGGCCGG - Intronic
1179096702 21:38322547-38322569 CACAGAGGGTGGGTGGGAGCAGG + Intergenic
1179457306 21:41508243-41508265 CACCCTGGGCGGGCGGGGGCGGG + Intronic
1180005476 21:45018737-45018759 GACAGGGAGCGGGTGGGGGCGGG + Intergenic
1180057364 21:45365793-45365815 CTCCGAGCGCGGGTGGAGAGAGG + Intergenic
1181022448 22:20110597-20110619 CACAGAGGGTGGGTGAGGGCAGG - Exonic
1181085608 22:20438036-20438058 CGCCGAGCGCTGGTGGAGGGAGG + Intronic
1182093202 22:27609703-27609725 CAGGGAGTGGGGGTGGGGGCGGG + Intergenic
1182355054 22:29719235-29719257 CCCAGAGCTGGGGTGGGGGCAGG - Intergenic
1183279818 22:36926040-36926062 CACGCAGCGGGGATGGGGGCAGG - Exonic
1184135796 22:42549176-42549198 CAGCAAGCGGGGGTGGGGGAGGG - Intergenic
1184656155 22:45943234-45943256 GCCCGAGCCCGGGTGGGGTCCGG - Intronic
1184795803 22:46731722-46731744 CCCCGGGAGCAGGTGGGGGCAGG + Intronic
1185229538 22:49672274-49672296 GCCCCAGCGGGGGTGGGGGCGGG + Intergenic
1185296163 22:50056383-50056405 CACCCACTGCGGGTGGGGACGGG + Intronic
1185317683 22:50186023-50186045 CACCGAGCGGGGGGCGGGCCCGG + Intronic
950012103 3:9731342-9731364 CACGGGGCGGGGCTGGGGGCAGG - Intergenic
951101567 3:18694129-18694151 CACCGTGCGCGAGTGGAAGCAGG - Intergenic
951685092 3:25335060-25335082 CAGCCAGCATGGGTGGGGGCTGG - Intronic
954028805 3:47803431-47803453 CATGGAGCCCGGGCGGGGGCGGG + Intronic
954211177 3:49098323-49098345 AACAGAGCTGGGGTGGGGGCAGG - Intronic
955182271 3:56683254-56683276 CAACGTGCGCGCGTCGGGGCCGG + Intergenic
956169271 3:66419824-66419846 CACCCTGCCCTGGTGGGGGCTGG + Intronic
958903850 3:99920656-99920678 CACTGAGGGTGGGTGGGGGCAGG - Intronic
960643325 3:119850211-119850233 CACGGAGTGCGGGTGAGGGTGGG + Intronic
961745908 3:129063294-129063316 CACAGAGCTCAGGTGGGAGCAGG + Intergenic
962891739 3:139678068-139678090 CAGCGGGCGGGGGCGGGGGCAGG - Intergenic
965734990 3:171810351-171810373 CACCGGGCGCCCGTGGGAGCCGG - Intronic
965773905 3:172209115-172209137 CAGTGAGCGGGGGTGGGGGTGGG + Intronic
966866531 3:184261495-184261517 GACCGGGCGGGGGCGGGGGCGGG + Intronic
966886342 3:184379892-184379914 CCCGGATCGCGGGTGGGGGAGGG - Intronic
968616423 4:1579513-1579535 CAACGCGCACGGGTGGGGCCAGG + Intergenic
968665043 4:1816391-1816413 TACTGAGCGTGGGTGGGGTCAGG + Intronic
968689517 4:1983544-1983566 CACCGGGCCGGGTTGGGGGCGGG - Intronic
968765986 4:2469426-2469448 CACCGAGCCCGGCTTGGCGCGGG + Intronic
971372377 4:26029168-26029190 CACCAGGGGTGGGTGGGGGCCGG - Intergenic
972284852 4:37638208-37638230 CACCTTGGGAGGGTGGGGGCAGG + Intronic
982592148 4:157326919-157326941 CAGGGAGCGCTGGTGGAGGCAGG + Intronic
985852501 5:2398847-2398869 CACCCAGCATGGGTGGGAGCAGG - Intergenic
988437578 5:31194026-31194048 CTGCGAGCCCGGGTCGGGGCGGG + Intronic
990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG + Intergenic
991263519 5:64690957-64690979 CTCTGAGGGCGGGTGAGGGCAGG + Intronic
992796088 5:80256120-80256142 CACGGGGCGGGGCTGGGGGCGGG - Intergenic
996185262 5:120465576-120465598 CTCCGGGCGGGGGCGGGGGCCGG + Intronic
997233029 5:132257587-132257609 CAGGGAGCGGGGGCGGGGGCTGG + Intronic
997309620 5:132868896-132868918 CACCGAGAGATGGTGGGGGTAGG + Intergenic
998285705 5:140858223-140858245 CACCGAGGGCGCATGTGGGCCGG + Exonic
998288233 5:140884449-140884471 CACCGAGGGCGCGTGCGCGCCGG + Exonic
1001120596 5:168976957-168976979 CACAGAGCTGGGGTGGGGGCTGG + Intronic
1002185912 5:177454752-177454774 CGCAGGGCGCGGGCGGGGGCCGG + Intronic
1002926962 6:1610391-1610413 GCCCGAGCGAGGGTGGGGGGCGG + Exonic
1004123147 6:12845431-12845453 CACGGAGGGCGGGGGGGGGGGGG - Intronic
1007830003 6:44630628-44630650 CCCCAAGCTCGGGCGGGGGCCGG + Intergenic
1008920876 6:56843481-56843503 CGGCGAGGGCGGGCGGGGGCCGG + Intronic
1010244798 6:73653513-73653535 CACCGGGCGGGGGCGGGGGCGGG - Intronic
1011470303 6:87701703-87701725 CGCCGGGCTCGGGTGGGGTCGGG + Exonic
1017877433 6:158536504-158536526 GACACGGCGCGGGTGGGGGCTGG - Exonic
1018909528 6:168094182-168094204 GACCGTGTGCGGGTGGGGGCAGG - Intergenic
1020257006 7:6508101-6508123 CACAGGGCACGGGTGGGGGCAGG + Exonic
1024063621 7:45716114-45716136 CACCTTGTGCCGGTGGGGGCTGG + Exonic
1026955290 7:74372890-74372912 CACGGTGGGGGGGTGGGGGCGGG - Intronic
1030348331 7:108456704-108456726 CTGCGAGCGCGTGTGGCGGCGGG + Intronic
1030573548 7:111257937-111257959 CACCGAGGCCTGTTGGGGGCTGG - Intronic
1034119697 7:148616262-148616284 CACAGAGCGGGGTTGGGGGACGG + Intergenic
1034564763 7:151904354-151904376 CACCGATGGCTGCTGGGGGCAGG + Intergenic
1035205767 7:157292988-157293010 CACCGGGCGCTGGGAGGGGCTGG - Intergenic
1035717269 8:1763895-1763917 CAGGGAGCCCGGGTGAGGGCCGG + Intronic
1036811121 8:11868167-11868189 CACCGTGCGCGGGCGGCGGGAGG - Exonic
1037891845 8:22627772-22627794 CTCCGAGGCCAGGTGGGGGCAGG + Intronic
1040569130 8:48592513-48592535 CAACATGTGCGGGTGGGGGCAGG + Intergenic
1041968185 8:63705087-63705109 TCCGGGGCGCGGGTGGGGGCGGG + Intergenic
1042696138 8:71556852-71556874 AGCAGGGCGCGGGTGGGGGCAGG - Intronic
1045111547 8:98942056-98942078 CGCCGAGGGCTGCTGGGGGCGGG + Intronic
1047870606 8:129077734-129077756 CTCCAAGCGGGGCTGGGGGCCGG + Intergenic
1048224890 8:132575670-132575692 CACTGGGCGCGGGGTGGGGCTGG + Intronic
1049101711 8:140584332-140584354 CACCGCGTGCTGGTGGGGGTGGG + Intronic
1049505178 8:142992327-142992349 CAGCTGGCGTGGGTGGGGGCAGG + Intergenic
1049592951 8:143470958-143470980 CACCGAGCAGGGGGTGGGGCTGG - Intronic
1050512956 9:6413663-6413685 CCCCTAGCGAGGCTGGGGGCCGG + Intronic
1053656553 9:40222751-40222773 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1053732884 9:41074832-41074854 CGGCGAGCGCGGGTGAAGGCTGG - Intergenic
1053906904 9:42851969-42851991 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1054368656 9:64368973-64368995 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1054528063 9:66153534-66153556 CAGTGAGGGCGGGTGGGGGAAGG - Intergenic
1054676284 9:67858725-67858747 CAGTGAGGGCGGGTGGGGGAAGG + Intergenic
1055408307 9:75999216-75999238 CACCGAGGCCTGTTGGGGGCTGG - Intronic
1056532465 9:87498764-87498786 CCCCGCGCGCGCGTGGGGCCGGG - Intronic
1056640986 9:88370329-88370351 CACCGAGAGAGGTTGTGGGCAGG + Intergenic
1059551909 9:115237479-115237501 CACTGAGCGTGGATGGGGGTGGG + Intronic
1060549372 9:124477810-124477832 CGGCGCCCGCGGGTGGGGGCGGG - Intronic
1060599892 9:124870406-124870428 CCCCCCGCACGGGTGGGGGCAGG + Intronic
1060700764 9:125747429-125747451 CGCCGCGCGCGGGCGGGAGCGGG - Exonic
1060811062 9:126611777-126611799 CGCGGAGCGCGGCTCGGGGCCGG - Intergenic
1060945912 9:127569198-127569220 GACCGAGGGCGGGGCGGGGCGGG - Intronic
1061028962 9:128068280-128068302 CTCCGGGCGCGGGCGGGAGCGGG - Exonic
1061235138 9:129337652-129337674 CACCTGGCGCGCGTGGGGGCAGG - Intergenic
1061262657 9:129488602-129488624 CCGCGAGGGCGGGAGGGGGCCGG - Intergenic
1062286002 9:135772757-135772779 CGCAGAGCGGCGGTGGGGGCGGG + Exonic
1062289073 9:135786529-135786551 CACACGGCGCGGGTGGGGGCCGG + Intronic
1062437034 9:136550948-136550970 CACAGAGCGTGGGTGGAGCCTGG + Intergenic
1062567198 9:137168555-137168577 CCCGGAGCGAGGGCGGGGGCGGG - Exonic
1062629309 9:137456596-137456618 CAGCCAGGGCGGGTGGGGGGAGG + Intronic
1187266244 X:17736978-17737000 CACAGAGCGCGGGGGAGGGGCGG + Intergenic
1188663052 X:32783993-32784015 CATGGAGCGGGGGTGGGGGGGGG + Intronic
1190881460 X:54495401-54495423 CACCGAGCCCCGGGGGGCGCCGG - Exonic
1198254676 X:134914787-134914809 CACCGAGGACGGCTGGGGGAGGG - Intronic
1200787604 Y:7273902-7273924 CCCCGCGGCCGGGTGGGGGCGGG + Intergenic