ID: 947437510

View in Genome Browser
Species Human (GRCh38)
Location 2:230085229-230085251
Sequence GGCCACTGAGATGGGGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947437510_947437519 16 Left 947437510 2:230085229-230085251 CCCCAGGCCCCATCTCAGTGGCC No data
Right 947437519 2:230085268-230085290 TCCTCGTTGAGTGCAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947437510 Original CRISPR GGCCACTGAGATGGGGCCTG GGG (reversed) Intergenic
No off target data available for this crispr