ID: 947442812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:230138009-230138031 |
| Sequence | CAGAAGACACAGAGGGAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947442812_947442816 | -7 | Left | 947442812 | 2:230138009-230138031 | CCTACCTCCCTCTGTGTCTTCTG | No data | ||
| Right | 947442816 | 2:230138025-230138047 | TCTTCTGCTCACAACATGACTGG | No data | ||||
| 947442812_947442817 | -3 | Left | 947442812 | 2:230138009-230138031 | CCTACCTCCCTCTGTGTCTTCTG | No data | ||
| Right | 947442817 | 2:230138029-230138051 | CTGCTCACAACATGACTGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947442812 | Original CRISPR | CAGAAGACACAGAGGGAGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||