ID: 947442812

View in Genome Browser
Species Human (GRCh38)
Location 2:230138009-230138031
Sequence CAGAAGACACAGAGGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947442812_947442816 -7 Left 947442812 2:230138009-230138031 CCTACCTCCCTCTGTGTCTTCTG No data
Right 947442816 2:230138025-230138047 TCTTCTGCTCACAACATGACTGG No data
947442812_947442817 -3 Left 947442812 2:230138009-230138031 CCTACCTCCCTCTGTGTCTTCTG No data
Right 947442817 2:230138029-230138051 CTGCTCACAACATGACTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947442812 Original CRISPR CAGAAGACACAGAGGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr