ID: 947443079

View in Genome Browser
Species Human (GRCh38)
Location 2:230140392-230140414
Sequence CAAAATGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947443076_947443079 4 Left 947443076 2:230140365-230140387 CCTAGAGACTTGTTGAGTGGTTG No data
Right 947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947443079 Original CRISPR CAAAATGCTGATAGTGATAT GGG Intergenic