ID: 947445372

View in Genome Browser
Species Human (GRCh38)
Location 2:230158741-230158763
Sequence GGGACAGAACTTTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947445372_947445374 -3 Left 947445372 2:230158741-230158763 CCTGCAGTGGAAAGTTCTGTCCC No data
Right 947445374 2:230158761-230158783 CCCGTAACACATGTACAGTAAGG No data
947445372_947445378 14 Left 947445372 2:230158741-230158763 CCTGCAGTGGAAAGTTCTGTCCC No data
Right 947445378 2:230158778-230158800 GTAAGGGGAACAAAGCAATATGG No data
947445372_947445379 30 Left 947445372 2:230158741-230158763 CCTGCAGTGGAAAGTTCTGTCCC No data
Right 947445379 2:230158794-230158816 AATATGGAGTCACTAAGCTAAGG No data
947445372_947445376 -2 Left 947445372 2:230158741-230158763 CCTGCAGTGGAAAGTTCTGTCCC No data
Right 947445376 2:230158762-230158784 CCGTAACACATGTACAGTAAGGG No data
947445372_947445377 -1 Left 947445372 2:230158741-230158763 CCTGCAGTGGAAAGTTCTGTCCC No data
Right 947445377 2:230158763-230158785 CGTAACACATGTACAGTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947445372 Original CRISPR GGGACAGAACTTTCCACTGC AGG (reversed) Intergenic