ID: 947448399

View in Genome Browser
Species Human (GRCh38)
Location 2:230182519-230182541
Sequence AGGGGGATTCACTTTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947448399 Original CRISPR AGGGGGATTCACTTTGGGGT TGG Intronic
900968300 1:5974913-5974935 GGGGGGATCTGCTTTGGGGTTGG - Intronic
901158747 1:7158871-7158893 AGGAGGTTTCCCTTTGGGTTAGG + Intronic
902081782 1:13826045-13826067 CAGGTGATTTACTTTGGGGTTGG + Intergenic
902733502 1:18384797-18384819 AAGGGGACTCACTTGGGGGAGGG + Intergenic
906688675 1:47778644-47778666 TGGGGCATTGACTTTGGTGTAGG - Intronic
906979071 1:50608635-50608657 AGGGGGAGACATTTTGGGGTAGG - Intronic
907247447 1:53117058-53117080 AGGGGGAATCACTTCGAGCTAGG + Intronic
907706637 1:56838294-56838316 AGGGAGTGTCACCTTGGGGTAGG - Intergenic
908682670 1:66679715-66679737 AGGGGGATCCTGTTCGGGGTGGG - Exonic
908820522 1:68081393-68081415 TGGGGGATGGAGTTTGGGGTAGG + Intergenic
911254258 1:95616061-95616083 AGGGAGGTTAACTTTAGGGTGGG + Intergenic
912474293 1:109925753-109925775 AGGGGCAGTCCCTTTGGGGTGGG - Intronic
917882249 1:179348737-179348759 AGGGGGGTTTGCTTTCGGGTGGG + Intronic
918454326 1:184692361-184692383 TGGAGAATTCACTTTGGGGAGGG - Exonic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
920368069 1:205458629-205458651 AGGGGGCTACAGTGTGGGGTTGG - Intergenic
920498000 1:206469075-206469097 ATGGGGTTTCACTGTGTGGTTGG - Intergenic
920498025 1:206469219-206469241 ATGGGGTTTCACTGTGTGGTTGG - Intergenic
922765153 1:228152660-228152682 AGGGGGCTTCACAGTGGGGGCGG - Intronic
1069823690 10:71242563-71242585 AGGGGGATCCACTTTGTAGCTGG + Intronic
1071220143 10:83456133-83456155 AAGAGCATTCACTGTGGGGTGGG + Intergenic
1075800812 10:125152194-125152216 AGGGGGCTTCACCTGGGGCTCGG + Intronic
1075817067 10:125272602-125272624 AGGGAGATTCACTCTGGGTATGG + Intergenic
1076195596 10:128515430-128515452 AGGCTAATTCACTTTGGGGAAGG + Intergenic
1079095762 11:17509345-17509367 AGGGACATTACCTTTGGGGTGGG + Exonic
1079745620 11:24125214-24125236 AGGGGGATTTACATCTGGGTAGG - Intergenic
1081752952 11:45525046-45525068 AGGGGGTGACAATTTGGGGTGGG - Intergenic
1083174496 11:60941078-60941100 AGGGGGCTGAACTTTGGGCTTGG - Intronic
1083626110 11:64072929-64072951 AGAGGGTTCCACTTTGGGGAAGG - Intronic
1089150524 11:116360312-116360334 AGGGGGAATAACTTGGGGGAAGG + Intergenic
1089731583 11:120522742-120522764 AGGGGATTTCAGTTTGGGGAAGG - Intronic
1090102089 11:123809401-123809423 AGAAGGATTCATTATGGGGTTGG - Intergenic
1090204895 11:124878668-124878690 AGGGGGTTTCCCTTCGGGATGGG - Exonic
1091373763 12:13286-13308 AGGGGGATGCACTGTTGGGGAGG + Intergenic
1092867268 12:12774315-12774337 AGGGTGAATCACTTTGGGTCAGG + Intronic
1094601097 12:31909582-31909604 AGGGGGATTTATCTTGGGGTTGG - Intergenic
1102230960 12:111261998-111262020 AGGGGAAGTCACTTGGGGGAGGG - Intronic
1102259756 12:111436821-111436843 AGGGGAATTCACTCTGGGTGGGG + Intronic
1104930051 12:132333965-132333987 AGCGGGAGTCACTTCGGAGTGGG - Intergenic
1107676361 13:42801951-42801973 AAGAGGCTTCATTTTGGGGTGGG - Intergenic
1116439140 14:44931461-44931483 AAAAGGATTCACTTTGGCGTGGG - Exonic
1122086745 14:99312889-99312911 AGGGGGATTCAGATGGGGTTAGG + Intergenic
1122667679 14:103344472-103344494 AGGAGGATTCACTTGGGTGTTGG + Exonic
1122953616 14:105059965-105059987 AGGGGGCATCACTTTGGAGATGG - Intronic
1127923742 15:63517555-63517577 AGTGGGCTTCACTGTGAGGTGGG + Intronic
1130841928 15:87708872-87708894 AAGGGGATTTACTATGGAGTTGG - Intergenic
1130980949 15:88811581-88811603 AGTGGAGTTCACTGTGGGGTGGG + Intronic
1133760876 16:8797562-8797584 GGGGTGATGCTCTTTGGGGTCGG - Intronic
1137444903 16:48525796-48525818 AGAGGGAAGCAGTTTGGGGTGGG - Intergenic
1137560548 16:49499430-49499452 AAGGGGATTGGCTTTGGGGTGGG + Intronic
1139375012 16:66491408-66491430 AGGGGGATTCAGCCAGGGGTTGG + Intronic
1142861536 17:2765096-2765118 GAGGGGAGTCACTTTGGGGCAGG + Intergenic
1142966823 17:3586874-3586896 AGGGAGCTTAAGTTTGGGGTGGG - Intronic
1143658734 17:8312199-8312221 ATGGGGGTGCACATTGGGGTTGG - Exonic
1144749891 17:17641337-17641359 AGGGTGATTCTCTATGGAGTTGG + Intergenic
1146835965 17:36110992-36111014 AGGGAGATTTACTTTCTGGTTGG - Intergenic
1152841367 17:82570918-82570940 TGGAGGCTTCACCTTGGGGTTGG - Intronic
1156684014 18:39622449-39622471 AGAAGGATTCACTTAGGGTTTGG - Intergenic
1160075799 18:75675370-75675392 AGGGAGAATGACTTTGGGGTAGG - Intergenic
1161657341 19:5524393-5524415 AGGGGGATGCAGTTTGCTGTTGG + Intergenic
1161998927 19:7731100-7731122 AGGGGCATGCATTTTGGGGCGGG - Intronic
1162452515 19:10763626-10763648 TGTTGGATTCACCTTGGGGTTGG + Intronic
1162471819 19:10876696-10876718 AGGGGGAGGCCCTTTGGCGTGGG + Intronic
1163004345 19:14388369-14388391 AGGGTGATGCACTTTGTGGGAGG - Intronic
1163063118 19:14774365-14774387 AGGGTGATGCACTTTGTGGGAGG + Intronic
1163327829 19:16616627-16616649 AGGTGTATCCACTTTGGAGTGGG + Intronic
1166094667 19:40531168-40531190 AGGGGGCTTTACTTTGAGGATGG + Intronic
1166714812 19:44960245-44960267 ACAGGGATCCACTTTGGAGTGGG - Intronic
1166995218 19:46716803-46716825 GGGGGAATTCACCTTGGGGGTGG + Exonic
1167894933 19:52572982-52573004 AGGGAAATTCAGTTGGGGGTGGG - Intronic
925931308 2:8710088-8710110 AGGGGAATAGGCTTTGGGGTCGG + Intergenic
929412308 2:41710792-41710814 TGGGAGATTCACAGTGGGGTAGG + Intergenic
929544238 2:42845376-42845398 AGGGGCCTTCTCTTTGGGGCAGG + Intergenic
930546758 2:52777498-52777520 TGATGGATTCACTTTGGTGTAGG - Intergenic
930769528 2:55117807-55117829 AGAGTGATTACCTTTGGGGTAGG + Intergenic
931246662 2:60498057-60498079 AGGGGTCTTCTCTTTGGGGGAGG + Intronic
931254086 2:60555131-60555153 AGCGGGCTTCACTCTGGCGTGGG + Intergenic
938042875 2:128090610-128090632 AGAGGTATTCATTTTTGGGTGGG + Intergenic
941614062 2:167698947-167698969 AGGTGGCTTCCCTTTGGGGATGG - Intergenic
944245433 2:197525506-197525528 AGGGAGGATCACTTTGAGGTTGG + Intronic
946304895 2:218850888-218850910 AGGGGGACTCACTATGTAGTGGG + Intergenic
946356507 2:219189022-219189044 AGTGGGACTGACATTGGGGTGGG - Intergenic
947448399 2:230182519-230182541 AGGGGGATTCACTTTGGGGTTGG + Intronic
948691159 2:239706032-239706054 TGGGGGATTCACATCTGGGTGGG + Intergenic
1169355449 20:4901297-4901319 AGGTTGATTCACCCTGGGGTGGG - Intronic
1170838412 20:19904465-19904487 AGGGCTACTCACATTGGGGTAGG + Intronic
1172573260 20:35986834-35986856 AGGGGCAGTCACAGTGGGGTGGG + Intronic
1173223313 20:41146625-41146647 TGGGGAGTTCACTTTGGGGTTGG + Intronic
1178106250 21:29322483-29322505 AGAGGAATTCTCTTTTGGGTGGG + Intronic
1179709389 21:43204228-43204250 AGGGTGATTCACTTTGTGGTGGG - Intergenic
1180177936 21:46099033-46099055 AGGGACCTTCCCTTTGGGGTCGG + Intronic
1183105178 22:35610363-35610385 AGTGGGGCTCAATTTGGGGTGGG - Intronic
1183130848 22:35834443-35834465 AGGGAGCTTCTGTTTGGGGTCGG + Intronic
949916948 3:8972513-8972535 AGGGAGGTTCACTTGAGGGTAGG - Intergenic
954383944 3:50234731-50234753 AGGGGCCTTCCCTTTGGGCTGGG + Intronic
956320016 3:67986077-67986099 AAGCTGATTCTCTTTGGGGTAGG - Intergenic
956876304 3:73467117-73467139 ATGGAGATTCACTTTCAGGTTGG + Intronic
961829935 3:129618271-129618293 TGGGGGACACACATTGGGGTGGG - Intergenic
974110611 4:57521119-57521141 AGGGGGATCTGCTTTGGGGGAGG + Intergenic
977924558 4:102685529-102685551 GGATGGATTCACTTTGGGATGGG - Intronic
981145368 4:141317676-141317698 AGGGGCATTAACTTTGGGCCTGG + Intergenic
990772889 5:59269658-59269680 AGAGGGTTTGAATTTGGGGTGGG + Intronic
994724343 5:103416576-103416598 GGGGGGCTTCACATTGGGTTGGG + Intergenic
997191635 5:131942503-131942525 AGAAGGATTCACTTTGGAGTAGG + Intronic
997448559 5:133962525-133962547 AGGGGGCATGACTTTGGAGTTGG - Intronic
1003960840 6:11207768-11207790 AGGGGGATGAACCTTGGAGTGGG + Intronic
1007187924 6:39988167-39988189 AGGGGGGTTTAACTTGGGGTGGG - Intergenic
1008206128 6:48659621-48659643 AGAAGAATTCACTATGGGGTAGG - Intergenic
1010044373 6:71423353-71423375 AGAGAAATTGACTTTGGGGTCGG + Intergenic
1010157149 6:72808283-72808305 AGGAGTATTCACTTTGGGAATGG + Intronic
1011628283 6:89301021-89301043 TGGTGGATTCACTTTTTGGTGGG - Intronic
1013288528 6:108700121-108700143 AGGGGGCCTCACTTGGGGCTGGG + Intergenic
1016124047 6:140376757-140376779 AGGGGTATTAATTTTGGGATAGG + Intergenic
1018828208 6:167423437-167423459 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828236 6:167423520-167423542 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828263 6:167423599-167423621 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828289 6:167423680-167423702 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828315 6:167423761-167423783 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828340 6:167423842-167423864 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828366 6:167423923-167423945 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1018828394 6:167424004-167424026 AGGGGGAGTCACCGTGTGGTGGG - Intergenic
1019924598 7:4183762-4183784 AGGGGGATTGGCTTTAGGGAAGG + Intronic
1020551829 7:9616073-9616095 AGGGAGATTCTCATTGTGGTGGG - Intergenic
1020826636 7:13036943-13036965 AGGAGAATTCACTTTGAGTTAGG - Intergenic
1023884297 7:44341443-44341465 AGTGTGATTCAGTTTGGAGTGGG - Intergenic
1025709189 7:63891571-63891593 TGGGGCCTTCACTTTGGGGAGGG - Intergenic
1026608088 7:71833079-71833101 AGGAGGAATCACTTTGGAGAAGG - Intronic
1027639063 7:80711880-80711902 ACTGGGATTCACATTTGGGTTGG + Intergenic
1028126309 7:87116825-87116847 ATGGGGGCTTACTTTGGGGTAGG - Intergenic
1028208242 7:88041231-88041253 GGGGGTATACACCTTGGGGTGGG + Intronic
1032000197 7:128260286-128260308 AGGAGGATTCTGTCTGGGGTGGG - Intergenic
1035422007 7:158737525-158737547 AGGGGTAGGCACTGTGGGGTGGG - Intronic
1038760117 8:30378235-30378257 AGGGGGATTGACTTAGGTATTGG - Intergenic
1039617292 8:38966286-38966308 AGGAGGGGTCACTTTGGGGATGG + Intronic
1043721440 8:83550087-83550109 AGTGGGATTAAGTTTGGTGTGGG - Intergenic
1044181708 8:89204072-89204094 ATGGATATTCACTTTGGGCTGGG - Intergenic
1045947035 8:107808067-107808089 AGAGGGATTCACTTTGGCCTTGG - Intergenic
1047612296 8:126532951-126532973 AGGGGAATTTACTCTGGGCTGGG + Intergenic
1048237292 8:132703518-132703540 AGTGGGATTCCTTTTGGGGGTGG + Intronic
1049680250 8:143914960-143914982 AGAGGGATTCAGTGTGGGGCAGG - Intergenic
1052973799 9:34397808-34397830 AGGGGGCATCAGTGTGGGGTGGG - Exonic
1055769936 9:79706135-79706157 AGGGAGAATCACTTTAGCGTAGG - Intronic
1057134079 9:92674433-92674455 ATGTGTATTCACTTTGGGGGCGG + Intergenic
1057298798 9:93864743-93864765 AGGAGTATTCACCTAGGGGTGGG + Intergenic
1058050444 9:100401199-100401221 AGGGGGGGTCAGTTTGGGATTGG - Intergenic
1058890131 9:109354430-109354452 AGGGGGCATAACTTTGGGGTAGG - Intergenic
1061537294 9:131258026-131258048 GTGGAGATTCACTTTGGGGTGGG - Intergenic
1062273474 9:135720199-135720221 AGCTGGATTCACTGTGGGGTAGG - Intronic
1186632417 X:11364453-11364475 AGGGGAAATCACTGTTGGGTAGG - Intronic
1187070327 X:15881232-15881254 AGAAGGGTTCACTTGGGGGTGGG - Intergenic
1187536647 X:20147042-20147064 AAGGGGATTCATTTTGGGAAAGG - Intergenic
1193535229 X:82707062-82707084 AGGGATATTCACTGTGAGGTGGG + Intergenic
1193588274 X:83355102-83355124 AGGGGGGATCACTTCAGGGTGGG - Intergenic
1193692844 X:84668368-84668390 AGTGGGCTTCACTTTGGCCTGGG - Intergenic
1197160171 X:123313995-123314017 AGGGGGCTTCACTTATGGGTTGG - Intronic