ID: 947448877

View in Genome Browser
Species Human (GRCh38)
Location 2:230186660-230186682
Sequence ATGGAGACTCAGAAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1308
Summary {0: 1, 1: 4, 2: 36, 3: 237, 4: 1030}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947448877 Original CRISPR ATGGAGACTCAGAAAGGAGA GGG (reversed) Intronic
900011690 1:116840-116862 ATGAAGACTCTTAAAGTAGATGG - Intergenic
900027794 1:293406-293428 ATGAAGACTCTTAAAGTAGATGG - Intergenic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900041749 1:472847-472869 ATGAAGACTCTTAAAGTAGATGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900063184 1:707825-707847 ATGAAGACTCTTAAAGTAGATGG - Intergenic
900651727 1:3733132-3733154 TTGGACACACAGGAAGGAGAGGG - Exonic
900724415 1:4206233-4206255 ATAGAGACTCAGAAGTGTGAGGG - Intergenic
900998227 1:6134297-6134319 GTGCAGAGTCAGAGAGGAGAGGG - Intronic
901102360 1:6728617-6728639 ATGAAGACACAGGGAGGAGACGG + Intergenic
902553940 1:17235682-17235704 ATGCAGACTCAGGAAGGGGAGGG + Intronic
902587973 1:17452892-17452914 ACTGAGACTCAGAAAGGTCAAGG + Intergenic
902619596 1:17643293-17643315 CTGAAGATTGAGAAAGGAGAGGG + Intronic
902664177 1:17926006-17926028 ACAGAGACTCAGAGAGGGGAAGG + Intergenic
902815743 1:18915624-18915646 ACTGAGACTCTGAGAGGAGAAGG - Intronic
902832599 1:19027140-19027162 ATGGAAACTCAGAAAATACAGGG + Intergenic
902889801 1:19434272-19434294 ATCGAGGCTCAGAGAGGTGAAGG - Intronic
903067858 1:20710826-20710848 ACTGACACCCAGAAAGGAGAAGG + Intronic
903330706 1:22595726-22595748 ATGGAGACCCAGGGAAGAGAAGG + Intronic
903414906 1:23175900-23175922 ATGGAGCCTCAGAGAGGGTAAGG + Intronic
903535594 1:24064281-24064303 ATGGAGGCCCAGGGAGGAGAAGG - Intronic
903727956 1:25465769-25465791 ATGCAGACTCGGAAAGACGAGGG - Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903758158 1:25677679-25677701 ATATAGACTCAGAAAGGGAAGGG - Intronic
903950063 1:26991515-26991537 GTGGAGACTCAGTGAGGGGAAGG - Intergenic
904747546 1:32720383-32720405 ATGGGGACTCAGTGAGGAGATGG + Intergenic
904990990 1:34592448-34592470 ATGGATACTCAGAGTGGTGAGGG - Intergenic
905123677 1:35702324-35702346 AAGGAGGCTCAGAAAGGGGCAGG + Intergenic
905473475 1:38209726-38209748 ACTGAGGCTCAGAGAGGAGATGG + Intergenic
905649782 1:39648433-39648455 AAGGAGAGTGAGAAGGGAGATGG + Intergenic
906077581 1:43063342-43063364 ACCGAGACTCAGAAAGGGGCAGG + Intergenic
906575408 1:46885018-46885040 ATGGGGACTCAGAGAAAAGATGG - Intergenic
906596568 1:47082877-47082899 ATGGGGACTCAGAGAAAAGATGG + Intronic
906659750 1:47573878-47573900 ATGGAGTCTCAGAGAGGGCAAGG + Intergenic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906882199 1:49603719-49603741 CTGGAGACTCAGAATGGGGGAGG - Intronic
906953205 1:50350783-50350805 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
907276733 1:53320956-53320978 ACTGAGGCTCAGAAAGGAGACGG - Intronic
907438498 1:54464287-54464309 AGGGATCCTCAGAAAGGTGAAGG + Intergenic
908075921 1:60517817-60517839 ATGGAAACTCAGCAAGCAGTAGG - Intergenic
908160206 1:61399917-61399939 ATTAAGACTGAGAAAGGAGAAGG - Intronic
908572967 1:65428381-65428403 AAGGAGACACAGAGAGGGGAAGG - Intronic
908675559 1:66599558-66599580 ATTCAGACTCAGAAGAGAGAAGG - Intronic
908771778 1:67603921-67603943 TTGGAGACTCAGAAATGGGGAGG + Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909132451 1:71754819-71754841 AGTGAAACTCAGAGAGGAGAGGG - Intronic
909238937 1:73187668-73187690 AAGAACAATCAGAAAGGAGAAGG - Intergenic
909357097 1:74722195-74722217 ACGGAGGCCCAGAAAGGAGGGGG + Intronic
909432031 1:75599493-75599515 ATGAAGATTGAGAAAGGAGATGG + Intronic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
910095293 1:83514860-83514882 GTGAGGACTCAGCAAGGAGATGG - Intergenic
910726433 1:90344754-90344776 ATGGAGAGTGAGAGAGAAGAAGG - Intergenic
910936638 1:92488343-92488365 AGGGACACGCAGAAAGGAGCAGG + Intergenic
911061080 1:93748327-93748349 ATGGAGAGTAAAAAGGGAGATGG - Intronic
911263799 1:95719370-95719392 ACTGAGACCCAGAAAGGTGATGG - Intergenic
911764448 1:101657004-101657026 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912849632 1:113111479-113111501 TTAGAGATTCAGAATGGAGAGGG - Intronic
914887325 1:151596036-151596058 ACCGAGACTCAGAGAGGTGAAGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915162397 1:153929736-153929758 ATGGAGAGTGAGAAAGGGAAGGG - Exonic
915478856 1:156171373-156171395 AAGGAGGCTCAGAATGGAGAAGG + Intronic
915565123 1:156708661-156708683 CTGGAGACTCAGTGAGGGGAGGG + Intergenic
915705097 1:157836147-157836169 ATGGAGACGCTGCAAAGAGACGG + Exonic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916453244 1:164941860-164941882 TTGGAGACTCTGAAGGGAGGAGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916790199 1:168118442-168118464 ATGGAGACTCACGAGGGTGAGGG + Intronic
917304447 1:173612608-173612630 AGGGAGACTGTGGAAGGAGAGGG - Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
917917569 1:179718878-179718900 CTGGAGACTCCAAAAGGGGAGGG - Intergenic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
918432512 1:184476784-184476806 TTGGAGACAAAGGAAGGAGATGG - Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919037930 1:192340395-192340417 AAAGAGACTCAGAAAGGTCAAGG + Intronic
919104369 1:193130450-193130472 TTTGAGACTGTGAAAGGAGATGG - Intronic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919450013 1:197760275-197760297 ATGGAGAGAAAGAGAGGAGATGG - Intronic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919607538 1:199704226-199704248 ATGGAGACCCCTAAAGTAGAGGG + Intergenic
920019675 1:202945849-202945871 ATGGAGACTTAGAAGCGGGAGGG + Intronic
920170083 1:204066478-204066500 AAAGATACTCAGAAAGGGGAGGG - Intergenic
920268121 1:204742208-204742230 AAGGAGACTCTGAAAGGTGGAGG - Intergenic
920270791 1:204762224-204762246 ATGGAGATACATCAAGGAGATGG + Intergenic
920390260 1:205595648-205595670 ATTGAGGCTCAGAGAGGGGAAGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920918900 1:210281572-210281594 ATAAAAACTGAGAAAGGAGATGG - Intergenic
921585753 1:216944362-216944384 ATGGAAAGTTAGAAAGGAAAAGG + Intronic
921877682 1:220217421-220217443 ATGGAAAAACAGAAAGGAGAGGG - Intronic
922260125 1:223932850-223932872 ATGAAGACTCTTAAAGTAGATGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
922860832 1:228814946-228814968 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
923142701 1:231174600-231174622 GTGGAGACAGAGAAGGGAGAGGG - Intronic
923249345 1:232165764-232165786 TTGGAGACTCAGAGTGGGGAGGG + Intergenic
923271869 1:232362724-232362746 ATAGAGACTAAGAAAGGCTAGGG - Intergenic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923561108 1:235042745-235042767 GTGAAGACTCAGAACGGAGGCGG - Intergenic
923751194 1:236747496-236747518 GTGGAGGCTCAGAAGGGTGAGGG - Intronic
923944843 1:238873026-238873048 TTGGAGACTCGGTAGGGAGAGGG - Intergenic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
924143377 1:241049008-241049030 ATGAAGACACAGACAGAAGAGGG - Intronic
924229749 1:241953568-241953590 ATAAAGTCTCAGAAAAGAGAAGG - Intergenic
924341292 1:243035409-243035431 ATGAAGACTCTTAAAGTAGATGG - Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
924811167 1:247403595-247403617 ATTGAGACACAAAAAGTAGAAGG - Intergenic
1063078507 10:2741425-2741447 ATGGAGACTGGGAAGGGTGAGGG - Intergenic
1063629872 10:7723362-7723384 CTGGGGACTCAGAGAAGAGAGGG - Intronic
1063820435 10:9828838-9828860 GTGGAGAATCTGAAAGGAGTGGG + Intergenic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065485492 10:26232862-26232884 ATAGAGACACAAGAAGGAGAAGG - Intronic
1065766444 10:29034662-29034684 ATGAAGACTCAGAAAAGTGAGGG + Intergenic
1065908827 10:30283649-30283671 ATGGAGACCTGGAAAAGAGAGGG + Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066050092 10:31626116-31626138 ATGGAGATTTGGAAAGGTGAAGG - Intergenic
1066325935 10:34358463-34358485 ATGGGGACTGAGGAAAGAGAGGG + Intronic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1066555257 10:36605476-36605498 ATGGTGACTCAGGATGAAGATGG + Intergenic
1066735180 10:38470025-38470047 ATGAAGACTCTTAAAGTAGATGG + Intergenic
1067104829 10:43359363-43359385 AGGGAGACACAGAAAGGAAGAGG + Intergenic
1067214960 10:44293774-44293796 ATGAACACTCAGAGAGGAAAAGG + Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1067968518 10:50942282-50942304 ATGGAGCCTCAGAAGTGTGAGGG + Intergenic
1068092965 10:52455354-52455376 AAGGTGAGTCAGAAAGGAGGTGG - Intergenic
1068538971 10:58269891-58269913 AAGAAGACTCAGAAAGCTGAAGG - Intronic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069132855 10:64728002-64728024 ATGGAGATTAAGAACAGAGAAGG - Intergenic
1069277893 10:66615460-66615482 AAGGAGACACAGGAAGGAGAAGG + Intronic
1069519558 10:69107828-69107850 ATGGGCACTGAGATAGGAGATGG + Intergenic
1069923808 10:71834168-71834190 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1070103495 10:73411284-73411306 TTAGAGACTCAGAAAGGGGAGGG + Intronic
1070166901 10:73905704-73905726 ATTCAGAATAAGAAAGGAGAGGG + Intergenic
1070826451 10:79393037-79393059 AGGAAGACCCAGTAAGGAGAAGG - Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1071575818 10:86725302-86725324 ATTGAGACTCAAAGAGGTGAAGG - Intronic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072868671 10:99092700-99092722 ATGGTGGCTCAGAAAGGCTAAGG - Intronic
1072875450 10:99168621-99168643 AGGTAGACTCACAAAGGGGAAGG + Intronic
1073248784 10:102109190-102109212 ACGGAGACTCAGATGGGAGAGGG + Intronic
1073688975 10:105786486-105786508 ATGGAGACACAGAGAGAAGGTGG - Intergenic
1073790465 10:106934899-106934921 CTGGAAACTCAGAAAAGGGAGGG + Intronic
1073863869 10:107778429-107778451 ATTAAAACTAAGAAAGGAGAAGG - Intergenic
1074122792 10:110505638-110505660 ATGGAAACACAGGAAGCAGATGG + Intronic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074370547 10:112897736-112897758 ATGGGGACTCAGAGAGGTGGAGG + Intergenic
1074598470 10:114889227-114889249 ATGGAGAATCAGCAAAGAAAAGG + Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075291978 10:121238489-121238511 AAGGAGAAGCATAAAGGAGATGG - Intergenic
1075953427 10:126501898-126501920 TCAGAGACTCAGAAAGGGGAGGG + Intronic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1075993396 10:126857229-126857251 AGAGAGACACAGAGAGGAGAAGG - Intergenic
1076143892 10:128101394-128101416 ATGCAGAATCAGAAAGGGAAAGG - Exonic
1076293186 10:129363465-129363487 TTAAAGACTCAGGAAGGAGAAGG - Intergenic
1076668923 10:132108505-132108527 GTGGAGCCTCAGACAAGAGAGGG + Intronic
1077957475 11:7036440-7036462 AGGGACACCCAGAAAGGAGGAGG + Intronic
1078080628 11:8202199-8202221 ATGGAAGCTCAGAAAAGAGGAGG + Intergenic
1078113927 11:8426178-8426200 ATGGGGAGCCAGAAGGGAGATGG + Intronic
1078416287 11:11168920-11168942 ATAGAGACTGCGAGAGGAGACGG + Intergenic
1078611247 11:12821348-12821370 ATGAAGACTCAGAAAGGTTTTGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1079906379 11:26253031-26253053 ATGGAGACAGAGGAAGCAGAGGG + Intergenic
1080001379 11:27354502-27354524 ATTGAGACACAGAAAGGTTAAGG + Intronic
1080047543 11:27825149-27825171 TTAGAGACTCAGAAAGGGCAGGG - Intergenic
1080192114 11:29563492-29563514 ATAGAGATACAGAAAAGAGAAGG - Intergenic
1080412485 11:32038817-32038839 AGGGAGATGCAGAAAGGAAATGG + Intronic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081017635 11:37903050-37903072 ATGGAGATTCACAATGGACAAGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081283591 11:41241512-41241534 ATGGAGAGTCAGAAATTTGAAGG + Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082710365 11:56547301-56547323 ATGGGGAGCCAGAAAGGGGACGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083886428 11:65575717-65575739 ACTGAGACCCAGAAAGGGGAAGG - Intergenic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084302662 11:68261642-68261664 ATGCGGACTCAGAAATGTGAGGG - Exonic
1084533106 11:69741022-69741044 ACGGGGACTCAGCAAGGTGAGGG + Intergenic
1084534102 11:69746652-69746674 CTGGAGACCCATAAAAGAGAAGG - Intergenic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084561710 11:69909309-69909331 ATGGTGACCCAGAGAGGAGCTGG - Intergenic
1084780249 11:71403526-71403548 ATGGAGGCTCAGAGAAGAGATGG - Intergenic
1085070414 11:73539124-73539146 ATGAAGACCCAGATAGGGGAAGG - Intronic
1085088673 11:73691080-73691102 AGGGACACACAGAAAGGGGATGG + Intronic
1085258199 11:75189046-75189068 ACGGAGGCCCAGAAAGGAGCAGG - Intronic
1085397040 11:76211631-76211653 ATGGAGACTTAGTGAGGACACGG + Intergenic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1086049252 11:82569328-82569350 ATGGAAGCTCAGAAGGGGGATGG - Intergenic
1086094803 11:83039736-83039758 ATGGAAGCTGAGAAAGGAGGCGG + Intronic
1086544721 11:87954337-87954359 AGGGAGAGACAGAGAGGAGATGG - Intergenic
1087335526 11:96839605-96839627 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1088554126 11:111044332-111044354 AAGGAGACTCAGAAGGGTGGGGG - Intergenic
1088930658 11:114347976-114347998 ATTGAGAGTCAGAATGCAGAGGG + Intergenic
1089018964 11:115191689-115191711 TGGGAGGCTCAGATAGGAGATGG + Intronic
1089780200 11:120868474-120868496 ATGGAAAGACAGAAAGGAAAAGG + Intronic
1090412599 11:126519395-126519417 ATGGAAACTCAGAGAGGCAAAGG - Intronic
1090701617 11:129301110-129301132 TTGGATACTTAGAAAGGAGTTGG + Intergenic
1090989813 11:131806599-131806621 AATGAGGCCCAGAAAGGAGAAGG + Intronic
1091020693 11:132096848-132096870 GTGGAGAGTCTGAGAGGAGAAGG + Intronic
1091174692 11:133547480-133547502 ATAGGGACTCAGAGAGGGGAGGG - Intergenic
1091206713 11:133826474-133826496 ATGGAGGCTCAGAGACTAGAGGG - Intergenic
1091327125 11:134699830-134699852 ATGGGGACTCCCAGAGGAGAAGG + Intergenic
1091351353 11:134899242-134899264 AGAAAGACTCAGAAATGAGACGG - Intergenic
1091363974 11:135001661-135001683 ACGGAGAAGCAGGAAGGAGAGGG + Intergenic
1091773439 12:3168771-3168793 GTGGAGACACAGAAAAGAGAGGG - Intronic
1091782102 12:3220435-3220457 CTGGAGAGTCAGGAAGGTGACGG - Intronic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093222121 12:16434027-16434049 ATGGGGACTGTGAAAAGAGATGG - Intronic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093370311 12:18356668-18356690 ATGGAGAGCTGGAAAGGAGATGG + Intronic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093564431 12:20585816-20585838 GTGAAGACACAGAAAGGAAAAGG - Intronic
1093705501 12:22270640-22270662 ATGGAGACTCAGAAAGGTAAAGG + Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094361734 12:29638400-29638422 ATGGGGATCCAGAAGGGAGATGG - Intronic
1094619895 12:32069979-32070001 ATGGGGACTCAGAAGGGTGGCGG - Intergenic
1094761608 12:33539714-33539736 ATTAAGACTCAGAAAGGAGTGGG + Intergenic
1094816512 12:34191756-34191778 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1095121730 12:38426906-38426928 ATGGAGACTCAGATAATACATGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095379976 12:41579296-41579318 ATGGACACAGAGACAGGAGAAGG - Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1095649732 12:44593235-44593257 ACTGAGATCCAGAAAGGAGATGG + Intronic
1096747713 12:53739244-53739266 ATGAAGACTCAGAAACGAGCAGG + Intergenic
1096791853 12:54050318-54050340 ATCGAGATTTAGAAAGGAGATGG + Intronic
1096943871 12:55382220-55382242 ATTAAGATTCAGAAAGGAAAAGG + Intergenic
1097136330 12:56859523-56859545 ATGGAGACTTGGAAGGGAGAGGG - Intergenic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1097855475 12:64456966-64456988 ATGGAGTCTGAGAAAGAAGCTGG + Intronic
1097967928 12:65601180-65601202 TTGGAGACACAGAAAGGAACTGG + Intergenic
1098109359 12:67105505-67105527 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1098455176 12:70664805-70664827 ATTGTATCTCAGAAAGGAGATGG - Intronic
1098480314 12:70950286-70950308 TTGGAGACTCAGAAGGGATGAGG - Intergenic
1098767925 12:74513817-74513839 ATTGAGAGTCAGAAAAGACATGG + Intergenic
1098870898 12:75815833-75815855 ACTGAGGCCCAGAAAGGAGAAGG + Intergenic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099582571 12:84469689-84469711 ATGGAGATTCAAAAGGGTGAAGG + Intergenic
1099653284 12:85456736-85456758 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101520439 12:105477550-105477572 TTAGAGACTCAGAAAGGGGAAGG - Intergenic
1101776825 12:107803079-107803101 ATGTATACCCAGAAGGGAGATGG - Intergenic
1101839174 12:108315618-108315640 ATGGAGGCTCAGAAAGGCTGTGG + Intronic
1101946738 12:109143129-109143151 TTGGAGACTCAGAGAGGGGAAGG - Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102418637 12:112786524-112786546 CTGGAGGCTCTTAAAGGAGAAGG + Intronic
1103260599 12:119585162-119585184 AAGGCAACTCAGAAAGGAGGGGG + Intergenic
1103367688 12:120394963-120394985 ATGCAGAGGCAGGAAGGAGAAGG + Intergenic
1103519859 12:121531098-121531120 GTGGAGACTCGGGAAGGAGGTGG - Intronic
1104210779 12:126686137-126686159 ATGGAGACACATGGAGGAGACGG + Intergenic
1104238305 12:126961237-126961259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104426750 12:128684214-128684236 ATGGAGATACAGAAACGAGTGGG - Intronic
1104873466 12:132016899-132016921 AGAGAGACTCAGGAAGGAGATGG - Intronic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1104939499 12:132388242-132388264 ATGGGGGCTCAGAGAGGGGAGGG + Intergenic
1105422373 13:20264478-20264500 ATGGAGGTTCAGAGACGAGAAGG + Intergenic
1105945747 13:25187985-25188007 GGGAAGAATCAGAAAGGAGATGG - Intergenic
1106202817 13:27555868-27555890 AAGGGGACTCAGAGAGGAGGTGG - Intronic
1107517573 13:41145958-41145980 ATGGACACACTGAAAGGTGAGGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109147862 13:58804357-58804379 ATGGGCAGTCAGAAAGTAGATGG + Intergenic
1109280932 13:60354500-60354522 TTGGATAATCAAAAAGGAGAAGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1109817478 13:67604294-67604316 ATGGACACTGAGAAAGCAGTAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1110094257 13:71496547-71496569 ATTGAGACTCAGAAGGGTGTGGG + Intronic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1110950461 13:81482759-81482781 ATGAGGATGCAGAAAGGAGAAGG - Intergenic
1110994996 13:82096697-82096719 CTGGAGGCTGAGACAGGAGAAGG + Intergenic
1111146282 13:84185098-84185120 ATGGAGGCTGAGAGAGGTGAGGG - Intergenic
1111162776 13:84417677-84417699 TTGCAGAGTCAGAAAGGACAAGG + Intergenic
1111547870 13:89767561-89767583 ATGAAGACACAGAAAGTAGTTGG + Intergenic
1111894913 13:94129452-94129474 CTGGAGACTTGGAAAGGAAATGG - Intronic
1112209725 13:97363654-97363676 ATGAAGACTCAGTAGGGATAGGG + Intronic
1112339281 13:98538986-98539008 AGGGGGACACAGAAAGGAAAGGG + Intronic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112798795 13:103087849-103087871 AGGGAGACTGAGAAAAGTGATGG + Intergenic
1112843048 13:103603668-103603690 ATTCAGAGTCAGAAAGTAGAAGG + Intergenic
1112912498 13:104505262-104505284 ATTGAGTCTCAGAAAGGTAAAGG - Intergenic
1113320987 13:109231914-109231936 ATTGAGGCTAAGAAAGGACAAGG + Intergenic
1113668806 13:112160987-112161009 ATGGAGAGTCAGAGAGCTGAAGG - Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114207022 14:20581624-20581646 AGGGAGAGTCAGGTAGGAGAAGG - Intergenic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114563555 14:23610988-23611010 AGGGAGACAAAGAAAGGAGGTGG + Intergenic
1114649761 14:24277057-24277079 ATGGAGAGTGAGGATGGAGAAGG + Intergenic
1114952514 14:27773645-27773667 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1114996939 14:28365485-28365507 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1115008511 14:28515865-28515887 ATGCAGAATTAGGAAGGAGAAGG + Intergenic
1115236041 14:31209212-31209234 ATGTAGACACTGAAAGGAAAGGG + Intergenic
1115475065 14:33805597-33805619 ATGGATACACATAAAGGACAGGG - Intergenic
1115475201 14:33806682-33806704 TAGGAGACACAGAAAGCAGAAGG - Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115838658 14:37440430-37440452 ATAGAGACTGAGAAAGGTGAGGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1115979138 14:39030262-39030284 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1116401254 14:44510389-44510411 ATGGAGACTCAGAAGTGTGTGGG - Intergenic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118480916 14:66164589-66164611 TTGGAGACCCACAAAGGAGGAGG + Intergenic
1119053569 14:71394811-71394833 ATGGATAAGCAGTAAGGAGAAGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120719863 14:87879183-87879205 ATGATGACTCAGAAAGGCCAGGG + Intronic
1120852564 14:89184660-89184682 ATGGAGACCCAGGAAGGTGAAGG - Intronic
1121086027 14:91146701-91146723 ATGGAAACTCAGAATGGAAGGGG + Intronic
1121142248 14:91553936-91553958 AAAGAGACTGAGAAAGAAGATGG - Intergenic
1121295806 14:92821016-92821038 ATGGAGGCACAGAATGGTGATGG + Intronic
1121491350 14:94363585-94363607 AGGGAGACTCAGAAACAACAGGG + Intergenic
1121844404 14:97160260-97160282 ACTGAGGCTCAGAAAGGTGAAGG - Intergenic
1122516459 14:102312344-102312366 TTGGAGACCCAGAGAGGAAAAGG + Intergenic
1122789942 14:104179908-104179930 CGGGAGTCTCAGAGAGGAGACGG + Intronic
1122908593 14:104815376-104815398 ATGCAGACACAGCAAGGAAAGGG - Intergenic
1123814533 15:23963025-23963047 CATTAGACTCAGAAAGGAGAAGG - Intergenic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124938492 15:34195416-34195438 ATGGAGACTCAGAGAGGTAGGGG + Intronic
1125744935 15:41991572-41991594 ATGGGGATTCAGAAAGGAATGGG - Intronic
1126304046 15:47234501-47234523 TTGGAGACTCAGGAAGGGGAAGG - Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126662196 15:51044158-51044180 ATAGAGGCAGAGAAAGGAGAGGG + Intergenic
1127714545 15:61636719-61636741 TTGGGGACTCAGAAGGGAGGTGG + Intergenic
1127823350 15:62680736-62680758 TTAGAGACTCAGAAGGGAAAGGG - Intronic
1127981371 15:64037731-64037753 ATGGAGGCTCAGAGAAGGGAAGG - Intronic
1128232608 15:66046142-66046164 ACTGAGGCTCAGAAAGGTGAAGG + Intronic
1128761500 15:70219243-70219265 ATGGAGGGTCAGAAAGGTCAGGG + Intergenic
1129151336 15:73689867-73689889 ATGAAGACCCAGAAAGGCAAGGG + Intronic
1129319237 15:74764737-74764759 ATGGAGGCTCTCACAGGAGATGG + Intergenic
1129673988 15:77622488-77622510 AGGGAGACTCAGAAAGGTGAGGG + Intronic
1129752663 15:78077060-78077082 AAGGTGTCTGAGAAAGGAGACGG + Intronic
1130043073 15:80421240-80421262 TTGGAGACTCAGAAGGGTGGAGG + Intronic
1130252491 15:82309074-82309096 ATGGAAAGACTGAAAGGAGAAGG + Intergenic
1130712278 15:86294911-86294933 ATGGAGACTCGGAAGGGTCAGGG - Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130991232 15:88877268-88877290 ATGGAGACACAGAAAAGGGCTGG + Exonic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131433253 15:92403181-92403203 ATGGAGACTCAGAGAGGTCTCGG + Intronic
1131565363 15:93480492-93480514 AAGGAGAATCACAAATGAGAGGG - Intergenic
1131646231 15:94348340-94348362 ATGGAGAGTGAGAGAGGAGAGGG - Intronic
1131952975 15:97701667-97701689 ATTGAGGTTCAGAAAGGAAATGG - Intergenic
1131994688 15:98122754-98122776 ATGAAGACTCAGAGAGAAGATGG - Intergenic
1132612256 16:823001-823023 ATGTAGACACAGAAAAGTGATGG + Intergenic
1133150390 16:3824155-3824177 ATGGAGTTTCAAAAGGGAGAGGG + Intronic
1133325752 16:4941178-4941200 ATGGGGAACGAGAAAGGAGAGGG - Intronic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133525083 16:6597311-6597333 ATGGAGACAGGGAAAGGAAAAGG - Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133596229 16:7295902-7295924 CAGGAAACTCAGAAATGAGAAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133720300 16:8488540-8488562 ACAGAGCCTCAGAGAGGAGATGG - Intergenic
1133886942 16:9838894-9838916 CTGGAGACTCAGAAAGGGAGAGG + Intronic
1134048155 16:11116669-11116691 ATGAAAACTGAAAAAGGAGAGGG + Intronic
1134145282 16:11755807-11755829 ATGAAGACACAGAACAGAGAAGG + Intronic
1134380914 16:13725097-13725119 TTGGAGACTCAGAAATGGGGAGG + Intergenic
1134874727 16:17687775-17687797 ATGGAGACTAAACAATGAGAGGG + Intergenic
1135119323 16:19751837-19751859 ATGCAGATTCAATAAGGAGAAGG - Intronic
1135159640 16:20082459-20082481 AGGGAGAATAAGAAAGGAGAAGG + Intergenic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135376469 16:21951882-21951904 ATGGAGACTCCGAAAGGTGGAGG + Intergenic
1135667071 16:24344949-24344971 ATGGAAAATCACAGAGGAGATGG - Intronic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1135678393 16:24436695-24436717 ATGGGGAGTTGGAAAGGAGATGG - Intergenic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1137520031 16:49184599-49184621 TGGGAGACTCAGAAATGACAAGG + Intergenic
1137541273 16:49363657-49363679 AAGGAGAGTCAGAGAGGAGGAGG - Intergenic
1137830220 16:51537104-51537126 ATGAAGACTCAGAAAGACTAAGG - Intergenic
1137940180 16:52676421-52676443 ATGATGAATCAGGAAGGAGAAGG - Intergenic
1137950959 16:52782823-52782845 ATGAAGACCCAGGAAGGTGAGGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138122389 16:54411158-54411180 CTGGAGACTGAGAGAGGTGAAGG + Intergenic
1138259685 16:55607271-55607293 ATGGAAACACACAAAGAAGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138540500 16:57684686-57684708 AGGGGGCCTGAGAAAGGAGAGGG + Intronic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1138741742 16:59318603-59318625 ATGGAGATTCTGAAGGGTGAGGG - Intergenic
1138768888 16:59638041-59638063 GTGGAGACTCTGCAAGGAGAGGG + Intergenic
1138800286 16:60018144-60018166 ATGGAGGCTTAGAAAGGTGAGGG - Intergenic
1138855337 16:60684464-60684486 ATGGACATTAAGAAATGAGAAGG - Intergenic
1138986520 16:62335458-62335480 AGGAAGACAAAGAAAGGAGAGGG + Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1140705238 16:77622657-77622679 TTGGAGACTGAGAAAGGGGAAGG - Intergenic
1141008832 16:80377837-80377859 ATGGAAACACAGAAAGGGAAGGG + Intergenic
1141479795 16:84298906-84298928 ACCGAGGCTCAGATAGGAGAAGG - Intronic
1141816503 16:86413721-86413743 ATTGAGCTTGAGAAAGGAGAAGG + Intergenic
1142308899 16:89300672-89300694 CTGGTGCCTCAGATAGGAGACGG - Intronic
1142452656 16:90190069-90190091 ATGAAGACTCTTAAAGTAGATGG + Intergenic
1143293124 17:5848113-5848135 CTGAAGACTCAGAAAGGAGGAGG - Intronic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1144302859 17:13939090-13939112 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1144403450 17:14929295-14929317 AAGGAGACCCTGAAGGGAGAGGG + Intergenic
1144788627 17:17845458-17845480 CTGGAGGCTCTGAAAGGAGCAGG - Intronic
1145231546 17:21177000-21177022 ATGAGGAGTCAGAAAGGAAACGG - Intronic
1145708479 17:26945313-26945335 ATGGAGACCCAGACACAAGATGG + Intergenic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146542442 17:33709093-33709115 ATGGAGACCCAGAAAGATGTAGG - Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1147375020 17:40018111-40018133 ATGGGAACCCGGAAAGGAGAGGG + Intergenic
1147452286 17:40513129-40513151 AAGGAAACCAAGAAAGGAGAAGG + Intergenic
1147653831 17:42077401-42077423 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1147705064 17:42420737-42420759 ATGGAGATTCTGAGAGAAGAGGG - Intronic
1147719180 17:42527875-42527897 CTGGAGGCTGAGACAGGAGATGG + Intergenic
1148070681 17:44906884-44906906 ACTGAGACTCAGACAGGAAAGGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148627003 17:49077226-49077248 CTGGTGACTCAGAAAGGATGCGG - Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1148748040 17:49929312-49929334 GATGTGACTCAGAAAGGAGAGGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149090246 17:52769396-52769418 ATGAAGACCCAGAAGGGAGAGGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149412024 17:56418671-56418693 ACTGAGACCCAGAAAGGTGAAGG + Intronic
1149564460 17:57631159-57631181 AGGGGGACTCAGAAAGGGGCTGG - Intronic
1150613420 17:66751300-66751322 AAGGAGACTTGGAGAGGAGACGG + Intronic
1151605831 17:75134986-75135008 ATGAAGACCCAGAGAGGAGTGGG - Intergenic
1151765393 17:76131017-76131039 ATGGGGAGAAAGAAAGGAGAGGG - Intergenic
1151905069 17:77042501-77042523 ATGCAGGCTCAGAGATGAGATGG - Intergenic
1151906913 17:77054753-77054775 GGGGAGACTGAGAGAGGAGAAGG + Intergenic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1153110346 18:1579036-1579058 ATGGAGACTCAGAAGAGAATTGG - Intergenic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154214961 18:12408739-12408761 ATGGAGACTCTGAAGGGTGAGGG + Intronic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156111416 18:33731824-33731846 AAGGAGACAGAGAAAGGAGAAGG - Intronic
1156338386 18:36188803-36188825 AGGGAGAGTCAGGAGGGAGACGG + Intronic
1156895193 18:42238299-42238321 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
1157410411 18:47458526-47458548 AGGGAGACAGAGAAAAGAGAAGG + Intergenic
1157903237 18:51541242-51541264 AATGACACCCAGAAAGGAGAGGG - Intergenic
1158048690 18:53188873-53188895 ACAGAGACACAGAGAGGAGAAGG - Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158344724 18:56504678-56504700 AGGGATGCTTAGAAAGGAGAAGG - Intergenic
1158369557 18:56784434-56784456 ATGGAGACTCAGAAGGGGAAGGG - Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158668160 18:59451340-59451362 AGGGAGACTCCAGAAGGAGAGGG - Intronic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158841894 18:61396743-61396765 ATAGAGGCTCAGAATGGAAAGGG - Intronic
1158867777 18:61654551-61654573 ATGGAGTCTCATAAGGTAGAGGG + Intergenic
1159116630 18:64121348-64121370 ATGAAGACTCAAAAAGGTAAGGG - Intergenic
1159537519 18:69734033-69734055 ACATAAACTCAGAAAGGAGAAGG - Intronic
1159882897 18:73876366-73876388 ATGGAGGCTCAGAAAAGTGATGG - Intergenic
1160397762 18:78584476-78584498 AGGGAGGCTCAGAGAGGACAGGG - Intergenic
1160397815 18:78584779-78584801 AGGGAGGCTCAGAGAGGACAGGG - Intergenic
1160410017 18:78668846-78668868 GTGGAGATACAGGAAGGAGATGG + Intergenic
1160644831 19:178689-178711 ATGAAGACTCTTAAAGTAGATGG - Intergenic
1160743566 19:699292-699314 ATGGGGACACAGTAGGGAGAGGG + Intergenic
1160911930 19:1478629-1478651 AGGGAGACTCGGAGAGGATACGG + Intronic
1161119989 19:2520451-2520473 ATGGAGGCTCAGAGAGGTTAAGG + Intronic
1161810858 19:6470450-6470472 ATGGAGACTCAGAGAGGGAAAGG - Intronic
1162000489 19:7741909-7741931 ATGGGGAATCCGAAAGGAAAAGG + Exonic
1162525605 19:11204397-11204419 ACGGAGGCTCACAAGGGAGATGG - Intronic
1162582207 19:11538405-11538427 ATAGAGGCCCAGAGAGGAGAAGG + Intergenic
1162899380 19:13785490-13785512 GCTGAGACTCAGAAAGGTGAAGG - Intergenic
1162964120 19:14148018-14148040 TTGGAGACAGAGAAAGGGGAAGG + Exonic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163262577 19:16199997-16200019 AGTGAGGCTCAGACAGGAGAAGG - Intronic
1163736424 19:18984077-18984099 GTGGAGAGCCAGAAAGGAGAGGG + Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164583394 19:29449369-29449391 ATTGAGTCTCAGAAAGGTTAAGG + Intergenic
1164667769 19:30052751-30052773 CTGGATACTCAGAAAAGAAAGGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1165001189 19:32763834-32763856 AGAGAGACTCAGAATGGACAGGG - Intronic
1165562878 19:36695729-36695751 AAGAAGACTGAGAGAGGAGATGG - Intronic
1165971661 19:39637004-39637026 TTGGACACTCAGAAAAGAAAAGG + Intergenic
1166184591 19:41131577-41131599 CTGGAGACACTGAAAAGAGATGG + Intergenic
1166207366 19:41280199-41280221 ATGGAGACTCAGAAGTGTTAGGG + Intronic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166317250 19:41996171-41996193 ATGGAGACTGGGAAAGGGGGAGG + Intronic
1166584790 19:43936089-43936111 ATGAATATTCAGTAAGGAGAGGG + Intergenic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167552318 19:50169695-50169717 ATAGAGACTCAGAGAGGAAGGGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167706176 19:51082516-51082538 CTGGAGACTCTGAGAAGAGATGG - Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167736714 19:51299076-51299098 GAGGAGACTCAGAGAGGATAAGG + Intergenic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168034690 19:53710014-53710036 ATGGAGCCTCAGGAACCAGATGG - Intergenic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168641997 19:58037019-58037041 CTGGAGACTCTGAAAAGAGAGGG - Intronic
925701808 2:6646423-6646445 ATGGAGTCCCAGAGAGGGGATGG - Intergenic
925860070 2:8166080-8166102 AAGCAGACGCAGAGAGGAGAGGG - Intergenic
926393725 2:12420402-12420424 AGGGAGACTCGGAAATGACAGGG - Intergenic
926544443 2:14222011-14222033 ATGCAGAATCATAAAGGAAATGG - Intergenic
926705299 2:15833372-15833394 ATGTGGCCTCAGAAAGGAGTGGG - Intergenic
926781568 2:16477405-16477427 ATGGAGACCAAGAAGCGAGATGG - Intergenic
926825503 2:16901800-16901822 TGGGGGAGTCAGAAAGGAGATGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927014348 2:18942013-18942035 ATGAAGACTGAGAGAGGTGAGGG - Intergenic
927153557 2:20209292-20209314 CTAGAGACTCTGAAAGGTGAGGG + Intronic
928096163 2:28406479-28406501 ACGGAGACCCAGAAAGGTGAAGG + Intronic
928479676 2:31669264-31669286 TTTGAGACTCAGAATGGGGAGGG - Intergenic
928819341 2:35342186-35342208 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
929568601 2:43006038-43006060 AAGGAGAAGCAGAAATGAGAAGG - Intergenic
929880908 2:45836718-45836740 GTGGAGAGTGAGAAAGGAGGAGG - Intronic
929913033 2:46108496-46108518 GTGGAGACTCAGAGAGGTCAAGG + Intronic
930087003 2:47504642-47504664 AGGGAGACTCATGAAGCAGAAGG + Intronic
930263328 2:49171768-49171790 AAGGAGAATCAGAAAAGAGTGGG + Intergenic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930517747 2:52430277-52430299 ATGGAGACTCAGTAATCAAAAGG - Intergenic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
930528325 2:52559784-52559806 TTAGAGACTCAGAAAGGGGAGGG - Intergenic
930590458 2:53320813-53320835 ATGGAGACTTACAGAGGTGATGG - Intergenic
930735160 2:54770962-54770984 ATGGAAACACAGAGAGGAGCAGG + Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
930950131 2:57131332-57131354 TTGGAGACTCAAAAAGGAGGAGG - Intergenic
932803101 2:74760137-74760159 TTGGTGACTCAGAAAAGAGAGGG - Intergenic
932815725 2:74860151-74860173 ATGGAGACTTGGAAGGGTGAGGG + Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
932944406 2:76210655-76210677 ATGCAGGCCCAGAAAGGACAGGG - Intergenic
933140294 2:78783821-78783843 ATAGAAATTCTGAAAGGAGAAGG + Intergenic
933294827 2:80477515-80477537 ATGGAGACTCAGAATGGGAAAGG - Intronic
933349856 2:81139416-81139438 GTGGAGACTTAGAATGGTGAGGG + Intergenic
933458335 2:82545669-82545691 ATGGAGACTAAGAAGGGTGGAGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
934102933 2:88670146-88670168 ATGGATACTCAGAGAGGTTAAGG + Intergenic
934484794 2:94695637-94695659 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
935408223 2:102732040-102732062 ATGGAGCCTCTGCAAGGAGCTGG - Intronic
935531284 2:104235179-104235201 ATGAAGACACACAAAGAAGAAGG + Intergenic
935702535 2:105824925-105824947 ATTGAGACTCAGGTGGGAGATGG - Intronic
935872595 2:107467769-107467791 AGGGAGACTCAGGAAGCAGTGGG - Intergenic
936140536 2:109936235-109936257 GTGAAGACACAGAGAGGAGATGG + Intergenic
936177227 2:110234180-110234202 GTGAAGACACAGAGAGGAGATGG + Intergenic
936204158 2:110435251-110435273 GTGAAGACACAGAGAGGAGATGG - Exonic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936533599 2:113293707-113293729 GTGGGGACTCAGAGAGGATAAGG - Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936932412 2:117803856-117803878 ATGGAGATGCAGAAATCAGATGG - Intergenic
937342195 2:121098457-121098479 ATGGAGGTTCAGAGAGGAGAAGG - Intergenic
937511607 2:122601702-122601724 ATGGAGATTCAGAAACGAAGGGG + Intergenic
937635058 2:124146109-124146131 ATGGAGGCACAGAGAGGAGCAGG + Intronic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938986592 2:136582460-136582482 ATGGATCCTCAGAGAGGACAAGG - Intergenic
939027417 2:137030758-137030780 CTGGAGACTCAGAAATGGGGAGG + Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939834107 2:147106981-147107003 ATGGAGACTCAGAGAGCAGTTGG + Intergenic
939914401 2:148021286-148021308 ATTGAGCCTGAGAGAGGAGAAGG + Intronic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940450664 2:153832215-153832237 GTGGAGACTAACAAAGGACAAGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941520997 2:166542858-166542880 ATGGGTACACAGTAAGGAGAAGG + Intergenic
941754822 2:169173837-169173859 ATGGGGACTGAGAGAGGACATGG - Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942087590 2:172457889-172457911 ATGAAGAAGCAGAAAGCAGATGG + Intronic
942747504 2:179251783-179251805 ATGAAGACACAGCAAGAAGATGG + Intronic
942981130 2:182083408-182083430 TTGGAGACTCAGAAATGGGCAGG - Intronic
943013208 2:182477442-182477464 ATTGAGGCTCAGAAAGGTCAAGG + Intronic
943029823 2:182671935-182671957 ATGGTCACTAAGAAAGGAGAGGG - Intergenic
943436200 2:187868141-187868163 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436207 2:187868191-187868213 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436234 2:187868385-187868407 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436252 2:187868532-187868554 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943436326 2:187869066-187869088 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
943617921 2:190115216-190115238 AAGGAGAAGTAGAAAGGAGAGGG + Intronic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943924284 2:193752004-193752026 ATGAAAACTCAGAAGGGTGAGGG - Intergenic
944082401 2:195802859-195802881 GAGGAGACTCAGAAGGGTGAAGG - Intronic
944143113 2:196478276-196478298 TTGGACAGGCAGAAAGGAGAAGG + Intronic
945075774 2:206038066-206038088 ATGAAGACTCAGAAGGGTGACGG + Intronic
945327680 2:208501550-208501572 CTAGAGACTCAGAAAGGGGGAGG - Intronic
945428774 2:209739795-209739817 AAGGGGAGTCAGAAAGGACAAGG + Intergenic
945665055 2:212730674-212730696 ATGGAGAATGAAAAAGGAAAAGG + Intergenic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946123316 2:217536235-217536257 ACAGAGACTGAGAAAGGATAAGG - Intronic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
946647754 2:221856427-221856449 TTGGAGAGTCAGAAAGGAACAGG + Intergenic
946735854 2:222753895-222753917 ATTGAGAGTCAGAAAAGAAAAGG - Intergenic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946779575 2:223179090-223179112 AAGAAGACCCAAAAAGGAGATGG + Intronic
946795897 2:223352419-223352441 ATAGAGACTCAGAAGCGAGAGGG + Intergenic
946832114 2:223737525-223737547 AAGGAGAAAGAGAAAGGAGAGGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946875545 2:224126139-224126161 CTGGAGCCTCAGCAAGGAGGTGG + Intergenic
947108563 2:226694184-226694206 ATGAAGACTGAGAAAGGAGGAGG - Intergenic
947420468 2:229937783-229937805 AAGCAGACTCAGAAGGGAAAGGG + Intronic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947531162 2:230909374-230909396 AGTGAGCCTCAGAAAGGTGAAGG - Exonic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948843980 2:240674501-240674523 TTGGAGCCCCAGGAAGGAGAGGG - Intergenic
948849832 2:240700134-240700156 TTGGAGCCCCAGGAAGGAGAGGG + Intergenic
949084097 2:242134724-242134746 ATGAAGACTCTTAAAGTAGATGG + Intergenic
1168751931 20:288679-288701 ACTGAAACACAGAAAGGAGATGG - Intronic
1168811470 20:707442-707464 ACTGAGACTCAGAGAGGAGCAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169292283 20:4362982-4363004 ATGGAGACTTGGAAGGGTGAGGG - Intergenic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1169340214 20:4790605-4790627 CTGGAGTCTGAGAGAGGAGAGGG + Exonic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169938826 20:10915092-10915114 ATGGAGACTTGGAAGGGTGAGGG + Intergenic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170834059 20:19868691-19868713 TTGGGGACCCAGAAAGGGGAAGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171252827 20:23662494-23662516 ATGGAGGCTCAGACGGGAGCAGG + Intergenic
1171268399 20:23793384-23793406 ATGGAGGCTCAGAGAAGAGCAGG + Intergenic
1171374537 20:24683374-24683396 CTGGAGACTCAGAACGGTGGGGG + Intergenic
1171778495 20:29394603-29394625 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1171820265 20:29829893-29829915 AAGGAGACTCAGCAGGGTGAGGG + Intergenic
1171822552 20:29867053-29867075 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1172056091 20:32155278-32155300 CTGGGGACTCAGAAAAGGGAAGG - Intronic
1172128906 20:32642822-32642844 ATGGTTACACAGCAAGGAGATGG - Intergenic
1172163922 20:32887156-32887178 ATGGATAATCAGAAGGGATAGGG - Intronic
1172166612 20:32903407-32903429 GTGGACACACAGAAGGGAGATGG - Intronic
1172198985 20:33112083-33112105 ATTGAGATTCAGAAAGGCTAAGG - Intergenic
1172245275 20:33441768-33441790 ACTGAGACTCAGAGAGGAGCAGG - Intronic
1172627986 20:36359592-36359614 ACCGAGCCTCAGAAAGGAGAAGG - Intronic
1172768724 20:37364618-37364640 ATGGAGGCTCAGAAAGGGAGAGG - Intronic
1172940070 20:38648129-38648151 ACTAAGACTCAGAAAAGAGAAGG + Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173641250 20:44603623-44603645 ACGGAGGCTCAGAAAGGGCAAGG - Intronic
1173648238 20:44646926-44646948 ACTGAGACTCAGAGAGGGGAGGG - Intronic
1173862659 20:46294399-46294421 CTGGGGCCTCAGACAGGAGATGG + Intronic
1173876630 20:46376415-46376437 AGGGAGAGTCAGGAGGGAGAGGG - Intronic
1173893471 20:46531504-46531526 ACTGAGGCTCAGAGAGGAGAGGG + Intergenic
1174101069 20:48126543-48126565 CCGGAGACGCAGAAAGGAGCTGG - Intergenic
1174149021 20:48473086-48473108 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149047 20:48473244-48473266 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149085 20:48473495-48473517 CTGGAGACCCAGAGAGGAGATGG - Intergenic
1174149524 20:48476308-48476330 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149532 20:48476361-48476383 CTGGAGACCCAGAAAGGAGTTGG - Intergenic
1174149559 20:48476515-48476537 CTGGAGACCCAGAAAGGCAATGG + Intergenic
1174149593 20:48476707-48476729 CTGGAGACCCAGAAAGGAAATGG - Intergenic
1174149601 20:48476760-48476782 CTGGAGACCCAGAAAGGAGCTGG - Intergenic
1174149627 20:48476918-48476940 CTGGAGACCCAGAAAGGAACCGG - Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174921978 20:54713098-54713120 ATGGGGACACAGAAAGAAGGTGG + Intergenic
1175597616 20:60247821-60247843 AGAGAGAGTGAGAAAGGAGAAGG - Intergenic
1175608635 20:60331872-60331894 AGGGAGGCACAGAAAGGCGAGGG + Intergenic
1176280682 20:64307212-64307234 ATGAAGACTCTTAAAGTAGATGG + Intergenic
1176347501 21:5763357-5763379 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176354315 21:5883941-5883963 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176497326 21:7561098-7561120 AAGGGGAATCAGCAAGGAGATGG + Intergenic
1176541822 21:8161427-8161449 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176560773 21:8344472-8344494 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1177123822 21:17170796-17170818 ATGGATACTTGGAAAGGCGAAGG - Intergenic
1177567985 21:22848076-22848098 AAGAAGGCTCAGAAATGAGAGGG + Intergenic
1178364017 21:31973531-31973553 ATGGAGACTGAGAAATCAGGGGG - Intronic
1178604749 21:34025960-34025982 AGGGAGACTCAGACTGGAGAGGG + Intergenic
1178755710 21:35347479-35347501 TTGGGGACTCAGAAAGGTGAGGG - Intronic
1178789590 21:35687735-35687757 ATGGAGGGACAGATAGGAGAAGG - Intronic
1178925849 21:36774316-36774338 GTGGAGACTCAGACAGGGAACGG + Intronic
1179057999 21:37953847-37953869 ATGGAGACACAGAGAGCTGAAGG + Intronic
1179095916 21:38314340-38314362 ATGGGGAGTCAGAAGGGGGATGG - Intergenic
1179195862 21:39161736-39161758 ATGAAGATGCAGGAAGGAGAGGG + Intergenic
1179362637 21:40726945-40726967 ATGGGGACTCAGAGAAGAGGGGG - Intronic
1179397001 21:41049711-41049733 TCAGAGGCTCAGAAAGGAGAGGG - Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1180926796 22:19560774-19560796 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1181090488 22:20469212-20469234 ATGGAAACACAGAACAGAGATGG + Intronic
1182049668 22:27303085-27303107 ATTGAGGCTCAGAGAGGTGAAGG + Intergenic
1182056193 22:27356930-27356952 ATTGTTACTCAGAAAGAAGAAGG + Intergenic
1182287706 22:29258118-29258140 ATGGACACTCAGGGAGGAGAGGG - Intronic
1182859963 22:33551033-33551055 ATGGAAACTCAGAAGGGTAAAGG + Intronic
1183119562 22:35719905-35719927 ATGGGGAGCCAGAAAGGGGATGG + Intronic
1183236133 22:36619110-36619132 ACCGAGACCCAGAAAGGTGAAGG + Intronic
1183305795 22:37082392-37082414 AGGGAGGCCCACAAAGGAGAAGG - Intronic
1183504222 22:38200186-38200208 CTGGAGGCTCAGAGAGGTGAAGG - Intronic
1183809069 22:40238637-40238659 ATGGAGACTCACTGAGGTGAGGG - Intronic
1184110698 22:42392454-42392476 AGAGAGAAACAGAAAGGAGAGGG + Intronic
1184472821 22:44705306-44705328 ATAGAGAGAGAGAAAGGAGAGGG - Intronic
1184604903 22:45567029-45567051 AGGGAGGCACAGAAAGGTGAAGG + Intronic
1184631131 22:45780927-45780949 CTTGAGACTCAGAAACGATAAGG + Intronic
1184803128 22:46774603-46774625 AGGCAGACTCAGGGAGGAGAGGG - Intronic
1184887969 22:47358087-47358109 ATGGAAACTCAGGCAGGAGTCGG - Intergenic
1184934172 22:47706934-47706956 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
1203246762 22_KI270733v1_random:77846-77868 AAGGGGAATCAGCAAGGAGATGG - Intergenic
949159278 3:860529-860551 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949159306 3:860776-860798 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
949160998 3:881790-881812 ATGGAGACCCACAAGGGTGAGGG - Intergenic
949516354 3:4810716-4810738 ATGGAGACTCAGAGGGGATGAGG + Intronic
949696927 3:6708372-6708394 ATGGAGACTCAGAAATTGAAAGG - Intergenic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
949988917 3:9561088-9561110 ATGAAGAGTCAGAAGGGCGAGGG - Intergenic
950128621 3:10526799-10526821 ATAGAGACTCAGAGAGGGGAAGG - Intronic
950186554 3:10949065-10949087 ATGGAGGCTCAGAGAGGAAGAGG - Intergenic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950467162 3:13162348-13162370 CTGCAGGCTCAGGAAGGAGATGG - Intergenic
950542893 3:13622664-13622686 ATGGGGCCTAAGAGAGGAGAAGG - Intronic
950552484 3:13675205-13675227 ATGGAGACTCGGGGAGCAGAGGG - Intergenic
950552923 3:13677816-13677838 ACTGAGACTCAGAGATGAGAGGG + Intergenic
950681403 3:14587671-14587693 ATTGAGACCCAGAAAAGAGAAGG - Intergenic
950945765 3:16944594-16944616 GTGAAGACACAGAGAGGAGATGG + Intronic
951145753 3:19224999-19225021 ATGAAGACTGAGAAAGAAAAAGG + Intronic
951203184 3:19897279-19897301 CTGGAAACTCACATAGGAGAGGG - Intronic
951262354 3:20525207-20525229 GTGGAGACTCAGAGAAGAGATGG - Intergenic
951438519 3:22693951-22693973 TTGGAGACTCGGAAAGGGGATGG - Intergenic
951514730 3:23545989-23546011 TTGGAGACTCAGAAGAGAGGAGG + Intronic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952899868 3:38103144-38103166 ACGGAGACTCGGAAGGGTGAGGG - Intronic
953137303 3:40192253-40192275 AGGGAGAATTAGAAAGGTGAGGG - Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953470668 3:43163408-43163430 ATGGAGAGTCAATAAGGAGCAGG + Intergenic
953636884 3:44671551-44671573 AAGGAGACTCGGACAGGACAGGG + Intergenic
953813692 3:46135506-46135528 AGGGAGGCTAAGACAGGAGATGG - Intergenic
953983796 3:47426373-47426395 AGGGAGACAAAGAAAGGAGCAGG - Intronic
954330729 3:49888831-49888853 ATTGAGGCCCAGAGAGGAGAAGG + Intronic
954517205 3:51189418-51189440 TTAGAGACTCAGAAAGGGGAGGG - Intronic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955060774 3:55489726-55489748 ATGGAGACTCAGGAGGTAAAGGG - Intronic
955344185 3:58148940-58148962 AAGGATGCTCAGAAAGGAAAAGG - Intronic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955612810 3:60775687-60775709 GAGAAGACTCAGAAGGGAGAGGG - Intronic
955763135 3:62310839-62310861 CGGGAGACTGAGACAGGAGAAGG + Intergenic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956044926 3:65185520-65185542 ATGGAGACAGAGACAGGAGTTGG + Intergenic
956390830 3:68771106-68771128 ATGGGGAGTCAGAAGGGGGATGG - Intronic
956735276 3:72233254-72233276 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
957038332 3:75315527-75315549 ACTGAGACCTAGAAAGGAGAAGG - Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
957092239 3:75742447-75742469 ATGCAGACTAAGATAAGAGAAGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
957771681 3:84701413-84701435 ATGAAGACTCAGAAGGGTGTGGG + Intergenic
957795669 3:85003094-85003116 ATGGAGATTCTCAAAGGATACGG - Intronic
958491170 3:94775670-94775692 CAGAAGACTGAGAAAGGAGAAGG - Intergenic
958632310 3:96700006-96700028 ATGGGGAGTCAGAAGGGATAGGG - Intergenic
958746963 3:98148085-98148107 ATGGAGACACAGAAAGGTTTTGG - Intergenic
958811821 3:98868610-98868632 TCGGAGACTCAGAAAGGGGGAGG - Intronic
958855931 3:99385617-99385639 ATGGAGACTCACAGCAGAGAGGG + Intergenic
959000829 3:100962275-100962297 ATGCAGAACAAGAAAGGAGAGGG - Intronic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959430798 3:106252412-106252434 GTGGAAACTCAGAAATGAAAAGG + Intergenic
959693371 3:109223552-109223574 ATGAAGACTCCAAAAGGAGGAGG + Intergenic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960880401 3:122339212-122339234 ATGAAGGCTCAGAGAGGAGGAGG - Intronic
961057882 3:123804343-123804365 GAGGAGACCCAGAAAGGAGAGGG + Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961086352 3:124070839-124070861 ACTGAGACCCAGAAAGGAGAAGG - Intergenic
961146979 3:124602361-124602383 GTGGAGACTCAGCAAGGACAGGG + Intronic
961174108 3:124820107-124820129 ATGGAGACACAGACAAGATATGG - Intronic
961396291 3:126593722-126593744 ATGAAGGCTAAGAAAGGTGAGGG - Intronic
961620414 3:128219496-128219518 ATGGGGAAACAGCAAGGAGAAGG - Intronic
961643871 3:128382066-128382088 CAGGAGACTCAGAGAGGAGAGGG - Intronic
961809773 3:129515066-129515088 ATGGAGACAGAGCTAGGAGAGGG - Intronic
961820290 3:129572453-129572475 ACTGAGGCTCAGAGAGGAGAAGG + Intronic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962637443 3:137345592-137345614 CTGGAGGCTGAGAGAGGAGAAGG + Intergenic
962704961 3:138034139-138034161 ATGGAGACTCAGAAAGTTTAAGG - Intergenic
963049263 3:141127714-141127736 ATGGAGACACAGGCTGGAGAAGG + Intronic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963168667 3:142229952-142229974 TTGGAGACCCAGAAATGGGAGGG + Intergenic
964248030 3:154676965-154676987 ATGGAGAAGTAGAAAGGAGCTGG - Intergenic
964629423 3:158794085-158794107 GTAGAGACTCAGAAGGGTGAAGG - Intronic
964773477 3:160249849-160249871 CTGGAGACTCAGGAAGGGGAGGG - Intronic
965400626 3:168208571-168208593 ATTGAGCATTAGAAAGGAGAAGG + Intergenic
966369283 3:179230980-179231002 ACAGAGACTCAGATGGGAGACGG - Intronic
966920174 3:184605898-184605920 ATGGAGACTCAAGCAGGAGTAGG + Intronic
967107624 3:186267120-186267142 GTGGAAACTCAGGAAGTAGAGGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967322085 3:188204663-188204685 ATTGAGGCTCAGAGAGCAGATGG + Intronic
967323475 3:188216610-188216632 AGTGAGACTCAGAAAGGGGCAGG - Intronic
967442835 3:189528647-189528669 ATGGAAACACAAAAAGTAGAGGG - Intergenic
967562261 3:190930303-190930325 ATGGAAACTCAGAACAGTGAGGG - Intergenic
968048844 3:195639967-195639989 AAAGAAACTCAGAGAGGAGAAGG - Intergenic
968268687 3:197382708-197382730 ACAGAAACTCAGAAAGGAAAGGG + Intergenic
968885421 4:3328225-3328247 ATGGAGACTTGGAAAGGTGAGGG + Intronic
969326389 4:6446813-6446835 AGGGAGGCTCAGAGAGGATACGG + Intronic
969897174 4:10316274-10316296 TTGGAGACTCAGAAGGGTCATGG - Intergenic
970165722 4:13235849-13235871 TTGGAGACTCAGAAAAGGGGAGG + Intergenic
970221422 4:13815836-13815858 ATGGAGACTCAGAAGGGTGTGGG - Intergenic
970234437 4:13944477-13944499 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
970525812 4:16930996-16931018 ATGAAGGCTCAGTAAGGAGAAGG + Intergenic
970681259 4:18511198-18511220 ATGGAAACAGAGAAAGAAGAGGG - Intergenic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
971975679 4:33683311-33683333 TTGGAGACTCAGAATGGGGGAGG - Intergenic
972390251 4:38607010-38607032 ATGGGGAGTCAGAAGGGGGATGG + Intergenic
972446038 4:39144713-39144735 CTGGAGACTCAGAAATGGGGAGG - Intergenic
973695061 4:53482688-53482710 TTGGAGACTCAGAAAAGGGGAGG + Intronic
973710821 4:53628962-53628984 ATGGAGGCTCAGAAGGGAAAGGG + Intronic
973884878 4:55310819-55310841 ACAGAGCCTCAGAAAAGAGATGG + Intergenic
973956587 4:56069003-56069025 ACGGAGACATAGAAGGGAGAAGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974074275 4:57154726-57154748 ATGGAAACTCGGAGAGGTGAGGG + Intergenic
974490058 4:62553146-62553168 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
974687285 4:65246344-65246366 TTCGAGAGACAGAAAGGAGAAGG + Intergenic
974962980 4:68726646-68726668 TTAGAGACTCAGAAAGGAGAGGG - Intergenic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975647553 4:76560217-76560239 ATGGAAACTGACAAAGGAAAGGG + Intronic
975707116 4:77122219-77122241 TTAGAGGCTAAGAAAGGAGAGGG + Intergenic
975802647 4:78077597-78077619 ATGGAGACTCGGAAGGGTGTGGG - Intronic
975870567 4:78775662-78775684 AAGGAGACTCTCAAGGGAGAAGG + Intergenic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976277553 4:83292845-83292867 TTGGAGACTCAGAAGGGAAGAGG + Exonic
977249728 4:94676380-94676402 ATGGAGACTTGGAAGGGTGAAGG - Intergenic
977509533 4:97945214-97945236 TTGGAGACTTAGAAAGGGGAGGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
977670476 4:99689280-99689302 ATATAGACTCAGAAGTGAGATGG + Intergenic
977707636 4:100088998-100089020 CTGGAGACTCAGAACGGGAAGGG - Intergenic
977910285 4:102526325-102526347 ATGGAGATTCAGAAAGGTGAGGG + Intronic
977954816 4:103014892-103014914 ATTGAGACTCAGAGAGGTTAAGG - Intronic
978352890 4:107838958-107838980 AGGAAGAGTCAGAGAGGAGAGGG - Intronic
978383564 4:108156838-108156860 GTAGAGACTCAGAAGGGTGAGGG + Intronic
978530205 4:109704519-109704541 ATGGAGGCTGAGAGAGGTGAGGG + Intergenic
978582609 4:110247356-110247378 ATGTAGACACAGAGAGGAAAGGG - Intergenic
978765846 4:112404078-112404100 CTGGAAACTGAGAAAGGAAAAGG - Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
978994061 4:115128116-115128138 ATGGTGACTCAGAAGGGTTAGGG - Intergenic
979261533 4:118652965-118652987 ATGAAGACTCTTAAAGTAGATGG + Intergenic
979267566 4:118721051-118721073 ATGAAGGCTCAGAGTGGAGAGGG - Intergenic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
981382603 4:144090620-144090642 ATGGAGAGTTGGAAAGGGGATGG - Intergenic
981738491 4:147977815-147977837 CTGGAGACTCCAAAAGGGGAGGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
981985256 4:150846551-150846573 ATGGAGACTCAGAACTCAGAAGG + Intronic
982381559 4:154754444-154754466 ATGGGGACCAATAAAGGAGAGGG + Intergenic
982422447 4:155213116-155213138 TTGGAGACTCATAAAGGAGAGGG + Intronic
982431777 4:155330889-155330911 TTGGAGACTCAGAAAGGTGGAGG + Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982812293 4:159841056-159841078 TTGGAGGTTCAGAAAGGAGGAGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983500588 4:168494987-168495009 ATGGAGTCTCAGAAAGGCTTGGG - Intronic
983506969 4:168564016-168564038 ATGGAGACTGGGAAGGGTGAAGG - Intronic
983752504 4:171293604-171293626 ATGGAGGCTGAGTAAGGACAGGG + Intergenic
983898523 4:173107108-173107130 TAGGAGACTCAGGAAGAAGAAGG + Intergenic
984278011 4:177633717-177633739 ATGGGGAATTGGAAAGGAGATGG - Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984782442 4:183538184-183538206 ATCGAGACTCATAAAGAATAAGG - Intergenic
984792484 4:183627359-183627381 ATGGAGAGTCAGATAGTAGCAGG - Intergenic
985042839 4:185909366-185909388 TTGGAGACTCAGAAGGGCTAGGG + Intronic
986165274 5:5267444-5267466 ATGGGGAGCCAGAAAGGGGATGG + Intronic
986169100 5:5301524-5301546 AGTGAGAGACAGAAAGGAGAAGG - Intronic
986435845 5:7730038-7730060 ATGGAGACTCCAAAGGGGGAAGG - Intronic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987268448 5:16280081-16280103 ATGGAGAGCTGGAAAGGAGATGG + Intergenic
987607027 5:20149677-20149699 ATGGATACTCACAAATGAGTTGG + Intronic
988065540 5:26226146-26226168 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065571 5:26226392-26226414 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065635 5:26226881-26226903 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988065654 5:26227075-26227097 CTGGAGACCCAGACAGGAGCTGG - Intergenic
988065721 5:26227617-26227639 CTGGAGACCCAGAGAGGAGCTGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988222331 5:28364241-28364263 ATGGAGACTCAGAAGGGTAGGGG + Intergenic
988261536 5:28892551-28892573 ATGGAGACACAGACGGGAAAGGG + Intergenic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
989443432 5:41500411-41500433 ATGGATACTCAGAAGGGTGAGGG + Intronic
989597283 5:43168288-43168310 TTGATGACTCAGAAAGGAAAAGG + Intronic
989634274 5:43517571-43517593 ATGAAGGCTGAGAAAGGTGAGGG + Intergenic
990476253 5:56164154-56164176 GTGGAGACCCAGAAAATAGAAGG - Intronic
990631461 5:57674755-57674777 AGGGAAACTGAGAAAGGGGAAGG - Intergenic
990656614 5:57963693-57963715 ATGGAGACACAGAAAGGTAAAGG - Intergenic
990989329 5:61669847-61669869 GGGGCTACTCAGAAAGGAGAGGG - Intronic
991298526 5:65105259-65105281 ATGGAGAGTGAGAAAAGAGGAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994109653 5:95986945-95986967 TTGGAGTGGCAGAAAGGAGATGG + Intergenic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
994388675 5:99163524-99163546 TTGGAGACTCAGAAATGGGAAGG + Intergenic
994415607 5:99466633-99466655 TTGAAAACTCAGAAAGGAGAAGG + Intergenic
994493835 5:100484566-100484588 ATGGATAGTCAGATAGAAGATGG - Intergenic
995779577 5:115761399-115761421 AGGGAGAGTAAGAAAGGAGAGGG + Intergenic
995820208 5:116221343-116221365 AGGGTGGCTGAGAAAGGAGATGG - Intronic
995907970 5:117149401-117149423 AAGGAGGCACAGAAAGGACAAGG - Intergenic
996272619 5:121625193-121625215 ATGCAGACTTAGAGAGAAGAGGG + Intergenic
996837536 5:127810482-127810504 CTGTATACCCAGAAAGGAGAGGG + Intergenic
996949804 5:129111769-129111791 AAAGAGAGACAGAAAGGAGAAGG - Intronic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998876101 5:146600985-146601007 AATGAGAATCAGAAAGTAGATGG - Intronic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999447520 5:151652037-151652059 ACTGAGTCTCAGAAAAGAGAAGG - Intergenic
999730105 5:154470579-154470601 ACTGAGGCTCACAAAGGAGAGGG - Intergenic
1000186753 5:158866077-158866099 ATGGAAGCTCAGAAAGGTGAAGG + Intronic
1000441347 5:161267432-161267454 TTGGAGACTCAGAAGTGAGGAGG + Intergenic
1000641073 5:163702265-163702287 TTAGAGACTCAGAAGGGTGAAGG - Intergenic
1001111563 5:168900937-168900959 ATGGAGCCTCAGAAGCGTGAGGG + Intronic
1001182224 5:169531148-169531170 ATCGAGGCTCAGATTGGAGAAGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001397446 5:171427523-171427545 GTGGAGACTCAGAGAGGTTAAGG - Intronic
1001412751 5:171522433-171522455 ATGGAGGCACAGAGAGGGGAAGG - Intergenic
1001425399 5:171619141-171619163 TTGGAGACACAGAAAAGTGATGG + Intergenic
1001433263 5:171680296-171680318 ATGGAACCACAGAAAGGAGCAGG + Intergenic
1001636210 5:173212104-173212126 ACTGAGGCTCAGAAAGGTGATGG - Intergenic
1002135892 5:177107326-177107348 AGGGAGACACAGAAAGGTCATGG - Intergenic
1002494144 5:179600299-179600321 ATGGAGACCCAGAAAGTAACTGG - Intronic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1002732095 5:181346082-181346104 ATGAAGACTCTTAAAGTAGATGG + Intergenic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002752437 6:128023-128045 ATGAAGACTCTTAAAGTAGATGG - Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003162232 6:3646135-3646157 AAGGAAACACCGAAAGGAGAAGG + Intergenic
1003498246 6:6683173-6683195 AGGGAGAGAAAGAAAGGAGATGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1003967379 6:11266020-11266042 ATGGAGACTTGGAAGGGAGAGGG + Intronic
1004093641 6:12530665-12530687 TTTGAGACTCAGGAAGGACATGG + Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004587939 6:17020844-17020866 ATGGAGACTCTTAAGTGAGAGGG - Intergenic
1004675572 6:17838760-17838782 ATGGAGACTTGGAAGGGTGAGGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005141328 6:22634881-22634903 TGGAAGACTCAGAAGGGAGAGGG - Intergenic
1005849507 6:29810917-29810939 ATGGAGACCCAGAAGGGTAAGGG + Intergenic
1005917601 6:30367036-30367058 ATGGAGACACAGAGAAGTGAAGG + Intergenic
1005918085 6:30371666-30371688 TTGGAGACTCAGAAATGACTGGG - Intergenic
1006166752 6:32069867-32069889 ATGGAGACACGGAGAGGAAACGG + Intronic
1006813095 6:36833227-36833249 ATTGAGGCTCAGAGAGGTGAAGG - Intronic
1006961796 6:37939359-37939381 ATAGAGACTCACAGGGGAGAAGG - Intronic
1007221840 6:40284835-40284857 ATTGAGACTCAGAAAGGTTATGG - Intergenic
1007277686 6:40687409-40687431 AGAGAGACACAGAGAGGAGATGG + Intergenic
1007350064 6:41265870-41265892 ATAGAGACTCAGAAGAGTGAGGG + Intergenic
1008019066 6:46555239-46555261 ATTGAGCCTCAGAAAGGGAAAGG - Intronic
1008319460 6:50090204-50090226 ATGAAGGCTAAGAGAGGAGATGG + Intergenic
1008381711 6:50845029-50845051 ATGGAGCCCAAGAAAGGAGCTGG - Exonic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1009052772 6:58297663-58297685 ATGCAGACACACAGAGGAGAAGG - Intergenic
1009238335 6:61152921-61152943 ATGCAGACACACAGAGGAGAAGG + Intergenic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009278340 6:61714881-61714903 ATGGAGACTCAGAAGAGTGGGGG + Intronic
1009321224 6:62291696-62291718 ATGGATACACATAAAGGAGGTGG + Intergenic
1009350257 6:62666781-62666803 AGAGAGACACAGAAAGAAGAAGG + Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1009832498 6:68956123-68956145 ATGGAGGCTCCGAATGCAGAGGG + Exonic
1010815465 6:80353062-80353084 ATGGAGACTCAGAGAGGAGAGGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011293282 6:85799795-85799817 ACGGAGACTTGGAAAGGGGAGGG - Intergenic
1011353675 6:86451572-86451594 ATTGAGACCCAAAAAGGAAAAGG - Intergenic
1011505860 6:88043211-88043233 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1011829146 6:91349606-91349628 ATGAAGACTGAGAGAGGTGAAGG + Intergenic
1011959921 6:93075271-93075293 ATGCTGACTAAGAATGGAGATGG - Intergenic
1012055203 6:94397999-94398021 AGTGAGAATCAGAAAAGAGAAGG + Intergenic
1012412557 6:98975675-98975697 AGGGAAACTCACAAGGGAGAGGG - Intergenic
1012462757 6:99482526-99482548 ATGGAGACACAGAAATTAAATGG - Intronic
1012634138 6:101514418-101514440 ATGGAGACAGGGAAGGGAGAGGG + Intronic
1012700028 6:102444390-102444412 TTGGAGACTCACAAGGGAGGAGG - Intergenic
1012823142 6:104114154-104114176 ATGGAAACTCAGAATGATGAGGG - Intergenic
1012848029 6:104414091-104414113 ATGGAGCAACAGAAAGGAGGTGG + Intergenic
1012902344 6:105020708-105020730 ATAGAGACTCAGAAGGGTGAGGG - Intronic
1012915447 6:105165512-105165534 ATAGAGAGTGAGAAGGGAGAAGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013508649 6:110824407-110824429 CTGGAGACTCAGAAAAGGGAGGG + Intronic
1013798127 6:113908309-113908331 ATGAGAACTCAGAAAAGAGAGGG + Intergenic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014012534 6:116492907-116492929 ATGGAGAGAAAGAGAGGAGATGG - Intergenic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014270455 6:119330382-119330404 ATGGAGAGTGAGAGAGGAAATGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015042867 6:128742809-128742831 ATGGGGAGCCAGAAAGGGGATGG - Intergenic
1015365920 6:132398052-132398074 ATAGAGACTCAAAAGGGTGAAGG - Intronic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015916506 6:138222872-138222894 CTGGAGACTCAGAATGGGGGAGG - Intronic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016275973 6:142352958-142352980 GTGGAGAGAGAGAAAGGAGAGGG - Intronic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016749397 6:147616036-147616058 ATTGAGCCTCAGAAAGGTTAAGG - Intronic
1017009595 6:150054298-150054320 CTGGAGACTCAGGGAGGAGCTGG - Intergenic
1017047157 6:150357439-150357461 ATGTAGACTCAGAAGTTAGATGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017938360 6:159027334-159027356 TTGGAGACTCAGAATGGGGGAGG + Intergenic
1018049108 6:159992370-159992392 CTGGAGACTCAGAAAGGTTGGGG - Intronic
1018438881 6:163789635-163789657 ATGCAGACAGAGAAATGAGAAGG - Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019708651 7:2508353-2508375 CTGGAGACTCCGGAAGGAGGAGG - Intergenic
1020360029 7:7318278-7318300 ATGGAGACACAGATAGGATAAGG + Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021252088 7:18342196-18342218 AGGAAGAATCAGAGAGGAGAGGG - Intronic
1021386620 7:20038925-20038947 AAGCAGACTGAGAAAAGAGAAGG - Intergenic
1021416529 7:20392681-20392703 ATGGAGACTTGGAAGGGTGAGGG - Intronic
1021760263 7:23896749-23896771 AAAGAGATTCAGGAAGGAGAGGG - Intergenic
1021811469 7:24406065-24406087 ATGCAAACTCAGTAAGGGGAGGG - Intergenic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022806686 7:33829579-33829601 ATGGAGAAGGAAAAAGGAGAAGG - Intergenic
1024094568 7:45973720-45973742 TGGGAGACTCAGAAAAGTGAGGG + Intergenic
1024272458 7:47652864-47652886 AGGGAGACTCAGAAGGGTGGAGG + Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024736533 7:52311149-52311171 ATGGACACACACAGAGGAGAAGG + Intergenic
1024923695 7:54588831-54588853 ATGGGAACTCACAAAGGACAAGG + Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026504589 7:70971437-70971459 AGAGAGACTCATAAAGGAGTTGG + Intergenic
1027221659 7:76218032-76218054 ACTGAGGCTCAGAAAGGAAAAGG + Intronic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1027424446 7:78048166-78048188 ATGGAGACTCTGAAATTAAATGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027838132 7:83272713-83272735 TCGGAGACTCAGAAGGGACAGGG - Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028401068 7:90426192-90426214 ATAGAGACTCAGGAAGGTGAGGG + Intronic
1028486196 7:91359993-91360015 ATGAGGACACAGTAAGGAGACGG + Intergenic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1029171084 7:98629261-98629283 AGGGGGGCTCAGAAAGGAGAAGG + Exonic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030506741 7:110434098-110434120 AAGGAGAATTACAAAGGAGAAGG - Intergenic
1030987602 7:116260982-116261004 ATGGAAACTCAGGGTGGAGATGG + Intergenic
1030991544 7:116307143-116307165 ATGGAGACTTAGAAGGGTGATGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1032496409 7:132366196-132366218 ATCAAGACTCAGAAAGCACAGGG - Intronic
1033454008 7:141486235-141486257 ACGGAGACCCAGAAAGGTGAGGG + Intergenic
1033740696 7:144273678-144273700 GTGTAGTATCAGAAAGGAGAAGG - Intergenic
1033753211 7:144375935-144375957 GTGTAGTATCAGAAAGGAGAAGG + Intronic
1033854192 7:145536916-145536938 CTGGAGACTGGGAGAGGAGATGG + Intergenic
1034071701 7:148192259-148192281 GTGGAGACTCAGAAGGGTGTAGG - Intronic
1034465464 7:151226009-151226031 ATGGAAACTGAGAAAGGGGCAGG + Intronic
1034473209 7:151267410-151267432 ATAGTGACTCAGAAAGAACACGG - Intronic
1034745885 7:153523760-153523782 GTGAAGACTCAGAGAGAAGACGG - Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035232021 7:157470877-157470899 ATGAAAACACAGAGAGGAGAAGG + Intergenic
1035328749 7:158082951-158082973 ATGGGCCCTCAGAAAGGAGGAGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035511426 8:188202-188224 ATGAAGACTCTTAAAGTAGATGG - Intergenic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035662419 8:1358194-1358216 ATGTGGACGCACAAAGGAGAAGG + Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036612505 8:10362558-10362580 TAGGAAACTCAGAAAGGGGATGG - Intronic
1036658172 8:10691015-10691037 CTGGTGACTCAGAAAGTGGAGGG - Intronic
1036787890 8:11700043-11700065 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037804121 8:22049779-22049801 AGGTAGTCTCAGAAAGAAGAGGG - Intronic
1037852192 8:22340585-22340607 ATGCAGACACAGACGGGAGAAGG + Intronic
1038333249 8:26626431-26626453 ATGGAGACACAGAATGGTAAAGG - Intronic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1038907606 8:31923866-31923888 ATGGAGACTTAGAGGGGTGAGGG - Intronic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1039098347 8:33911922-33911944 ATGAAGACTCAGAAGGGTGAGGG + Intergenic
1039407630 8:37326732-37326754 ATGGAAACAAAGAGAGGAGAGGG + Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1040787395 8:51181613-51181635 TGGGAGAGCCAGAAAGGAGATGG - Intergenic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1041499583 8:58525933-58525955 CTGGAAAGTCAGAAAGGTGAGGG + Intergenic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1041918302 8:63157864-63157886 ATGGGGAGTCAGAAAGGGGATGG + Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042482737 8:69322568-69322590 CTGGAGACCCAGAAAGGAGCTGG + Intergenic
1042482998 8:69324528-69324550 TTGGAGACCCAGAGAGGAGCTGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1043242362 8:77951405-77951427 AAGTAGAGTCAGAGAGGAGATGG + Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1043509139 8:80932416-80932438 CTGCAGAATCAGAAAGGAAAGGG + Intergenic
1043543032 8:81283762-81283784 AAGTAGACTCAGAAAGGAGAAGG + Intronic
1043736315 8:83749771-83749793 TTGGAGACTCAGAAGGGTAAAGG - Intergenic
1043964065 8:86451801-86451823 AAGGAGATTCCAAAAGGAGATGG - Intronic
1044376044 8:91472300-91472322 CTGCAAAATCAGAAAGGAGATGG - Intergenic
1044542406 8:93422519-93422541 AATGAGAATCAGAGAGGAGAGGG - Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044921470 8:97173917-97173939 GTGGAGATTCAGCAAGGAGCTGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045068659 8:98477573-98477595 GTGGAGACTGAGATAGGAAATGG - Intronic
1046042409 8:108921846-108921868 ATGGAGAGACAGAAAAAAGAAGG + Intergenic
1046118299 8:109811713-109811735 ATGCAGACTCACATGGGAGAAGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046277442 8:111982237-111982259 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1046975836 8:120276345-120276367 TTGGAGACTCAGAGTGGGGAGGG + Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047022640 8:120792333-120792355 TTGGAGACTCAGAAAAGGGGAGG + Intronic
1047028197 8:120847593-120847615 ATGAAGACACAGAAAGAAGCTGG + Intergenic
1047102531 8:121694111-121694133 ATGGAGACTTTGAAGGGTGAGGG + Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047217300 8:122886935-122886957 ATGGAGGCTCAGATAGGTTAAGG + Intronic
1047504099 8:125465224-125465246 TTGGAGACACAGAGAGGTGATGG - Intergenic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1047586521 8:126279690-126279712 ATGGGGAGCCAGAAGGGAGATGG - Intergenic
1047713731 8:127576580-127576602 AGGAAGACTGGGAAAGGAGAAGG - Intergenic
1047727578 8:127697256-127697278 CTGGAGAGTCAGAAAGGCCAAGG - Intergenic
1047727719 8:127698620-127698642 ATGGGAACTTAGAAGGGAGAGGG - Intergenic
1048186435 8:132246021-132246043 ATCTAGACACAGAAACGAGAAGG + Intronic
1048351846 8:133623050-133623072 GAGGAGACACAGGAAGGAGAGGG - Intergenic
1048714330 8:137251155-137251177 AGGGAGACTCAGAAGGGTGCAGG + Intergenic
1048994672 8:139786891-139786913 AGGGAGGGTCAGAAAGGAGCAGG + Intronic
1049033893 8:140059954-140059976 AAGCAGACTCAGAAATGATAAGG - Intronic
1049324419 8:142014618-142014640 ACGGAGACACAGACAGGAGCAGG - Intergenic
1049978858 9:885408-885430 TAGGGGAGTCAGAAAGGAGATGG + Intronic
1050454430 9:5819691-5819713 AGGGAGACTCTCAAAGAAGATGG - Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051287604 9:15512389-15512411 ATGGTGACTAAGAAAAGGGAAGG + Intergenic
1051769742 9:20564331-20564353 GAGGAGACTTAGAAAAGAGATGG + Intronic
1052208163 9:25869004-25869026 GTGAAGACTCAGAAAGGAGGAGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1052865463 9:33462322-33462344 AAGAAGACTAAGAAAGGAGTGGG + Exonic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053205159 9:36179886-36179908 ATGGAAACCCAGAAAAGAGCAGG + Intergenic
1053286443 9:36852375-36852397 ACTGAGTCTCAGAAAGGAGAAGG + Intronic
1053439540 9:38104980-38105002 ATGGTGAATCCAAAAGGAGATGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053672999 9:40388733-40388755 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1053750139 9:41245072-41245094 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1053922809 9:43015102-43015124 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054255638 9:62809411-62809433 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1054335673 9:63806196-63806218 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1054384108 9:64528799-64528821 TTGGAGACTCAGAGCGGGGAGGG - Intergenic
1054511626 9:65987550-65987572 TTGGAGACTCAGAGCGGGGAGGG + Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054880347 9:70138061-70138083 GTGGAGACTTAGAAGGGTGAGGG - Intronic
1055003060 9:71475154-71475176 AAGAAGACTCTGAAAGGTGAAGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055356509 9:75443059-75443081 TTGGGGAGCCAGAAAGGAGATGG + Intergenic
1056024712 9:82481754-82481776 TTGGAGTTTCAGAAAGTAGATGG - Intergenic
1056281703 9:85047846-85047868 TTGGATACTCAGAAAGGGGGAGG - Intergenic
1057012412 9:91616883-91616905 ATTGAAGCTCAGAAAGGGGAAGG + Intronic
1057301848 9:93891039-93891061 ATGGAGGCTCTGAGAGGAGAAGG + Intergenic
1057509863 9:95669317-95669339 AAGAAAACTCAGAAAGGAGTGGG + Intergenic
1057755601 9:97832405-97832427 GTTGAGACTCAGAAAAGAGAAGG - Intergenic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1057889877 9:98861808-98861830 ATTGAGACTCAGAGAGGGTAAGG + Intergenic
1058030011 9:100185707-100185729 TTGGGGACTCAGAAAGGGGAAGG - Intronic
1058412342 9:104747738-104747760 GAGGAGTCTCAGAAAGGACACGG + Exonic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058608773 9:106752682-106752704 AGAGAGACTCAGAGAGGAGAAGG - Intergenic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059643904 9:116245144-116245166 ATGGACACTCAGAAGGGTGGGGG + Intronic
1059828225 9:118058118-118058140 ATGGAGACTCAGAAGCCTGAGGG - Intergenic
1059849534 9:118321849-118321871 ATTCAGAGTCATAAAGGAGAGGG - Intergenic
1059990082 9:119856775-119856797 ATGGAGACTGGGAAGGGTGAAGG - Intergenic
1060050930 9:120377625-120377647 ATGCAGACACAGCAAGAAGATGG - Intergenic
1060562710 9:124559826-124559848 ATTAAGACTAAGAAATGAGAAGG - Intronic
1060832119 9:126723222-126723244 ATGGACACCGAGAAAGGAGAGGG - Intergenic
1060975335 9:127761840-127761862 ATGCAGGCTCAGAGAGGTGAAGG - Intronic
1060976780 9:127769822-127769844 ACTGAGACTCAGAGAGGGGAAGG - Intronic
1061074805 9:128334607-128334629 ATGGGGACTCAGAGAGGGGAAGG - Intergenic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1061268728 9:129524131-129524153 ATGGAGACTTAGAGATGAGAAGG - Intergenic
1061456638 9:130703026-130703048 AAGGAGACACAGAGAGGGGAAGG - Intronic
1061629639 9:131863972-131863994 ATGGAGACGCAGAGAGGATAAGG - Intronic
1062756495 9:138298417-138298439 ATGAAGACTCTTAAAGTAGATGG + Intergenic
1203463096 Un_GL000220v1:60908-60930 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1203371924 Un_KI270442v1:315169-315191 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1203375609 Un_KI270442v1:373678-373700 ATGGAGACTCGGCAGGGTGAGGG + Intergenic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1203608542 Un_KI270748v1:76009-76031 GTGGAGAGGGAGAAAGGAGAGGG + Intergenic
1185485829 X:481459-481481 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485860 X:481573-481595 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485877 X:481628-481650 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485894 X:481683-481705 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185485970 X:481942-481964 AAGGAGACGGAGGAAGGAGAGGG + Intergenic
1185679110 X:1873746-1873768 AAGGAGACTGAGAAAGGAGAGGG - Intergenic
1185679114 X:1873782-1873804 AAGGAGACTGAGAAAGGAGAGGG - Intergenic
1185679121 X:1873841-1873863 AGAGAGAGTCAGAAAGGAGAGGG - Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185943489 X:4347809-4347831 TTGGAGACTGGGAAAGGGGATGG + Intergenic
1186286230 X:8046718-8046740 ATGGGGAGCCAGAAAGGGGATGG + Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187287855 X:17923290-17923312 ATGGAGGCTCAGAGAGGACGTGG - Intergenic
1187475001 X:19602827-19602849 ATGGAGGCTAAGTAAGGTGAGGG + Intronic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188101032 X:26088163-26088185 TTAGAGATTCAGAAAGGGGAGGG + Intergenic
1188137585 X:26508634-26508656 AGGGAGGCTCAAAAGGGAGAAGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188181439 X:27060815-27060837 ATGGAGGCTCAGAAGGGTGGAGG - Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188606832 X:32041482-32041504 ATGTTAACTCAGAAAGCAGAAGG - Intronic
1188607450 X:32049527-32049549 ATGGAGACTCTGAAGGGATAAGG - Intronic
1188780209 X:34273961-34273983 TTGGACACTCAGAAAGGTGAGGG - Intergenic
1189107040 X:38247261-38247283 ATACAGACTCAGAAAAGTGATGG + Intronic
1189363885 X:40373549-40373571 AAGGAGAGGCAGACAGGAGAGGG + Intergenic
1189494377 X:41495827-41495849 ATGGAAATTCAGAAGGGTGAGGG - Intergenic
1189699379 X:43701275-43701297 AAGGAGCCTCTGAGAGGAGATGG - Intronic
1189761658 X:44328143-44328165 ATGGAGACTTGCAAGGGAGAAGG - Intronic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190220439 X:48509199-48509221 AGGGAGAGTCGGAAAGGTGATGG - Intronic
1190553362 X:51608473-51608495 ATGGTGAGTCTGAAAGGAGAAGG - Intergenic
1190735767 X:53255249-53255271 AAAGAGAATGAGAAAGGAGAAGG + Intronic
1190780737 X:53592484-53592506 AGAGAGACTAAGCAAGGAGAAGG - Exonic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193342311 X:80363624-80363646 ATGGAAACTAAGACAGGAAATGG - Intronic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193525852 X:82587911-82587933 ATGGAGACTCAGACAGGTGGAGG - Intergenic
1193747628 X:85301046-85301068 ATGGGGACTCCACAAGGAGAGGG + Intronic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1194047497 X:89026546-89026568 TTGGAGACTCAGAAGAGAGGAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194597336 X:95874658-95874680 TTAGAGTCTCAGAAGGGAGAGGG + Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195031898 X:100934359-100934381 CTGGAAATTCAGAAAAGAGATGG + Intergenic
1195152410 X:102085394-102085416 ATGTAGCATCAGAAAGTAGAAGG - Intergenic
1195916009 X:109936020-109936042 ACTGAGACTCAGAAAGGTTAAGG - Intergenic
1195966715 X:110435596-110435618 TTGGAGACTCAGAAAGAAAGTGG - Intronic
1196049773 X:111292658-111292680 GTGGAGACAAAGAAAGTAGATGG - Intergenic
1196458131 X:115904048-115904070 ATGGAGACTCAGCACAGAGTAGG + Intergenic
1196796847 X:119508749-119508771 CTAGAGACTCAGAAAGGGGAGGG - Intergenic
1197545034 X:127813618-127813640 ATGGACACACAGAAAAGAGCAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198307893 X:135400609-135400631 ATGGAGGCTGAGAAAGCAGCAGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198489218 X:137122174-137122196 ATGGAGATTTGGAAAGGTGAGGG + Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1198676451 X:139136354-139136376 TTAGAGACTCAGAACGGGGAGGG - Intronic
1198784754 X:140274560-140274582 AAGGAGTCTCAGAAAGGTGAAGG - Intergenic
1198804801 X:140483660-140483682 ATGCAAGCCCAGAAAGGAGAAGG - Intergenic
1198883409 X:141306528-141306550 ATGGGGAGCCAGAAAGGAGATGG - Intergenic
1198949727 X:142057122-142057144 TTCGGGACTCAGAAAGGACAAGG + Intergenic
1199010842 X:142756738-142756760 TTGGAGACACAGAGAGGGGAGGG - Intergenic
1199053038 X:143259827-143259849 CTGGAAACTCAAAAAGCAGATGG + Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic
1200022070 X:153220189-153220211 TTGGAGCCTCATCAAGGAGAGGG - Intergenic
1200092189 X:153641228-153641250 ATGGAGACCCAGATGGGACAGGG + Intergenic
1200377259 X:155796259-155796281 TTGAAGACTCAGAAAGGGGGAGG - Intergenic
1200427395 Y:3036395-3036417 AAGGAGACTCAGAGAAGAAAAGG + Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200690383 Y:6303074-6303096 ATGGGGACCCACAAGGGAGATGG + Intergenic
1200710125 Y:6475873-6475895 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1200883074 Y:8240962-8240984 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200940573 Y:8775978-8776000 ATGGGGAGCCAGAAGGGAGATGG + Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1200985270 Y:9296841-9296863 ATGGGGAGCTAGAAAGGAGATGG + Intergenic
1201023990 Y:9688835-9688857 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1201044890 Y:9871642-9871664 ATGGGGACCCACAAGGGAGATGG - Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic
1201302474 Y:12521286-12521308 ATCAAGACTCACAAAGAAGAGGG - Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1201761461 Y:17543930-17543952 ATGGAGACTCAGCAGGGTGAGGG + Intergenic
1201840091 Y:18362060-18362082 ATGGAGACTCAGCAGGGTGAGGG - Intergenic
1201921551 Y:19239454-19239476 ATGGAGTCTTTGACAGGAGAGGG - Intergenic
1202071790 Y:20999522-20999544 ATGCAGGCTCAGGTAGGAGATGG + Intergenic
1202107191 Y:21384020-21384042 ATGGTGAGCCAGAAGGGAGATGG + Intronic
1202111115 Y:21421701-21421723 ATGGGGACCCAGAAGGCAGATGG + Intergenic
1202117356 Y:21482454-21482476 ATGGGGACCCAGAAGGGAAATGG - Intergenic
1202183592 Y:22160047-22160069 ATGGGGAGCCAGAATGGAGATGG + Intergenic
1202200009 Y:22336240-22336262 ATGGGGAGCCAGAAGGGAGATGG - Intronic
1202207767 Y:22426354-22426376 ATGGGGAGCCAGAATGGAGATGG - Intergenic
1202233324 Y:22678768-22678790 ATGGGGAGCCAGAAGGGAGACGG - Intergenic
1202309832 Y:23517390-23517412 ATGGGGAGCCAGAAGGGAGACGG + Intergenic
1202560969 Y:26153203-26153225 ATGGGGAGCCAGAAGGGAGACGG - Intergenic