ID: 947452069

View in Genome Browser
Species Human (GRCh38)
Location 2:230217718-230217740
Sequence CATAGTTAGCACTGTAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947452069_947452074 20 Left 947452069 2:230217718-230217740 CCAGGCTTACAGTGCTAACTATG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 947452074 2:230217761-230217783 CTGGGTTAAACAAGATGACCTGG 0: 1
1: 0
2: 1
3: 9
4: 125
947452069_947452072 2 Left 947452069 2:230217718-230217740 CCAGGCTTACAGTGCTAACTATG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 947452072 2:230217743-230217765 TTCTATGGCCACACTGATCTGGG 0: 1
1: 0
2: 0
3: 5
4: 120
947452069_947452071 1 Left 947452069 2:230217718-230217740 CCAGGCTTACAGTGCTAACTATG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 947452071 2:230217742-230217764 GTTCTATGGCCACACTGATCTGG 0: 1
1: 0
2: 0
3: 4
4: 91
947452069_947452076 27 Left 947452069 2:230217718-230217740 CCAGGCTTACAGTGCTAACTATG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 947452076 2:230217768-230217790 AAACAAGATGACCTGGGCTACGG 0: 1
1: 0
2: 2
3: 26
4: 233
947452069_947452075 21 Left 947452069 2:230217718-230217740 CCAGGCTTACAGTGCTAACTATG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 947452075 2:230217762-230217784 TGGGTTAAACAAGATGACCTGGG 0: 1
1: 0
2: 0
3: 11
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947452069 Original CRISPR CATAGTTAGCACTGTAAGCC TGG (reversed) Intronic
906697162 1:47830736-47830758 TATTGTTGGCACTGTGAGCCAGG + Intronic
906829026 1:49012233-49012255 GATAGTTAGCTCTGAAACCCAGG - Intronic
908639816 1:66210235-66210257 CATAGTCACCACTGTCAGTCAGG + Intronic
909732661 1:78914041-78914063 AGTAGTTAGCATTGTAAACCAGG - Intronic
916886552 1:169074177-169074199 CATAGATAACACTGAAAGCCAGG + Intergenic
921578989 1:216873812-216873834 CATTGTTAGCACTTGGAGCCTGG + Intronic
922298762 1:224276531-224276553 AATAGTTGGCACTGTAGGCCGGG - Intronic
1064083651 10:12328547-12328569 CAGAGTTTGCACTGTCACCCAGG + Intergenic
1068243599 10:54336841-54336863 GATAGTTTGCACTGCATGCCTGG + Intronic
1069664204 10:70144203-70144225 CTTAGTGAGCACTGTGGGCCAGG + Intronic
1070389620 10:75958114-75958136 CATAAGTAGCAGTGTAACCCTGG - Intronic
1072090714 10:92124577-92124599 CAGTGTGAGCACTATAAGCCAGG + Intronic
1073281083 10:102354692-102354714 CATAGTTAGCCTAGAAAGCCTGG + Intronic
1076426721 10:130372326-130372348 CATAGCTGGCACTCTGAGCCTGG - Intergenic
1076565705 10:131397631-131397653 CATAGATAGCACAGCAAGGCAGG + Intergenic
1076658590 10:132040234-132040256 CAGAGGCAGCTCTGTAAGCCAGG + Intergenic
1079716775 11:23757119-23757141 CATAGCTTGCACTGTGTGCCTGG + Intergenic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1086620698 11:88884105-88884127 TATAGCTTGCACTGTATGCCTGG + Intronic
1088048418 11:105480816-105480838 GATAGTTTGCACTGTGTGCCTGG + Intergenic
1093491825 12:19713676-19713698 CATAGTTAGCAAACTAACCCAGG - Intronic
1096769368 12:53924600-53924622 CCTACTTACCACTGTGAGCCAGG - Intergenic
1112064699 13:95780841-95780863 CATAGTTAGCACTGTGACGCGGG - Intronic
1112775551 13:102839832-102839854 CATCGTAATCACTGTAACCCTGG - Exonic
1113869607 13:113550892-113550914 CATAGCAAGTACTTTAAGCCAGG + Intronic
1114257406 14:21015195-21015217 CATAGATAACACTGTCAGCAGGG - Intergenic
1115783427 14:36796903-36796925 CAGAGTTAGAAATGGAAGCCAGG - Intronic
1116378364 14:44232284-44232306 AATAGCTTGCACTGTGAGCCTGG - Intergenic
1116862721 14:50007493-50007515 CATAGTTACCACTGGGAGCAGGG - Exonic
1117409271 14:55435909-55435931 TATAGTTTCCACTGTAAACCTGG - Exonic
1119806571 14:77486070-77486092 CTTAGTTTCCACTGTAAGACAGG - Intronic
1124021382 15:25927869-25927891 AAGATTTAGCACTGTAACCCAGG - Intergenic
1124221277 15:27851799-27851821 CATAGTTAGCACAGCACTCCAGG - Intronic
1132471818 16:108542-108564 AATGGTTAGCACTGGAAGGCTGG + Intronic
1135880391 16:26249783-26249805 CATGGTAAGCACTGTAGGACTGG - Intergenic
1152700034 17:81814132-81814154 CAGAGTTGGCACTGGAACCCCGG + Intergenic
1153259717 18:3211820-3211842 CATAGTTTCCACTTTAACCCTGG + Intronic
1157474246 18:48011306-48011328 CATAGTTAGCATTGCAGACCAGG + Intergenic
1157714514 18:49874187-49874209 AATAGTTAGAACTCTAGGCCTGG - Intronic
1159643249 18:70888025-70888047 AATAGCTTGCACTGTAAGCCTGG + Intergenic
1168376042 19:55880396-55880418 CATGTTTGGCCCTGTAAGCCAGG + Intronic
925148483 2:1599041-1599063 CATAGTTAGGAAAGTGAGCCTGG - Intergenic
929239956 2:39643852-39643874 CAAAGGTAACACTGTAACCCTGG - Intergenic
930490653 2:52065927-52065949 CATAGTTATGACTGTACACCAGG + Intergenic
933585763 2:84178025-84178047 CATACCTGGCACTTTAAGCCAGG - Intergenic
935030914 2:99321428-99321450 CATAGCAAGCAATGTAAGCTAGG + Intronic
939344696 2:140949381-140949403 CATATTTTGCAAAGTAAGCCAGG + Intronic
942228514 2:173837802-173837824 CAGTGTTAGCACTGTAAACCAGG + Intergenic
942647370 2:178127624-178127646 CATTGTTAGCAATTTAACCCTGG + Intronic
947452069 2:230217718-230217740 CATAGTTAGCACTGTAAGCCTGG - Intronic
1172407914 20:34703166-34703188 CACAGTCAGGACTGAAAGCCAGG + Intronic
1177761077 21:25402659-25402681 GATAGTTTGCACTGTTTGCCTGG + Intergenic
1183944258 22:41315664-41315686 CACAGTGAGGTCTGTAAGCCAGG - Intronic
1184338921 22:43874783-43874805 GATAGCTTGCACTGTACGCCTGG + Intergenic
954092249 3:48294533-48294555 CAGAAATGGCACTGTAAGCCAGG + Exonic
957686548 3:83509894-83509916 CATAGTTTGCTAGGTAAGCCTGG + Intergenic
957774048 3:84732486-84732508 CATAGTTAGCAATATGAGTCTGG + Intergenic
958423695 3:93957451-93957473 TACAGCTAGCAGTGTAAGCCAGG + Intronic
958907977 3:99962648-99962670 CACATATAGCACTGTAGGCCTGG + Intronic
963273287 3:143306312-143306334 CATAGAAAGCACTGAAAGCCAGG + Intronic
963351468 3:144157267-144157289 CAAAGTTAGAACTTTAACCCAGG - Intergenic
967286363 3:187874534-187874556 CAGCGTTAGCACTGAAATCCCGG + Intergenic
969355331 4:6621662-6621684 CACAGTTACCACTGGCAGCCTGG - Exonic
972314580 4:37914148-37914170 GGTAGTTAACACTGTAAGACTGG - Intronic
973789539 4:54365344-54365366 CATATTTAGCACCGTAAGTCAGG - Intergenic
979139182 4:117151025-117151047 AACAGTTTGCACTGTAAGCCTGG - Intergenic
979304946 4:119131709-119131731 CAGAGTTAGCACTGTAACTGAGG + Intergenic
979482135 4:121231659-121231681 TCCAGTTATCACTGTAAGCCAGG + Intergenic
979847820 4:125538750-125538772 CCTAGTTAGCACTTCAAGTCAGG - Intergenic
987659859 5:20858103-20858125 CAAAGTTAAAACAGTAAGCCTGG + Intergenic
987721542 5:21639774-21639796 CATAATTAGCACTGAAATCATGG + Intergenic
988763786 5:34347543-34347565 CAAAGTTAAAACAGTAAGCCTGG - Intergenic
988895772 5:35673203-35673225 CATGGGTAGCAGTCTAAGCCAGG + Intronic
994019019 5:95002366-95002388 CACAGCTTGCACTGTATGCCTGG + Intronic
996802754 5:127421655-127421677 CATACTTAGGACTGTGAGTCAGG + Intronic
997237569 5:132282393-132282415 CCTATATAGTACTGTAAGCCAGG - Intronic
999103033 5:149043153-149043175 CATAGTCAACACTGTAAACTTGG - Intronic
1000297500 5:159924910-159924932 CATGGAGAGCACAGTAAGCCTGG - Intronic
1000350819 5:160351043-160351065 AATATTTAGCACTGTGGGCCAGG - Intronic
1000485218 5:161833244-161833266 CATAGTCAGAACTGTATTCCTGG + Intergenic
1005139588 6:22612894-22612916 GAGAGTTAGTACTCTAAGCCTGG - Intergenic
1007588280 6:43006303-43006325 CACAGTTATCTCTGTAACCCTGG + Intronic
1009851738 6:69207657-69207679 CATAGTTAGCATTGTAATTGTGG + Intronic
1009900965 6:69807619-69807641 CATAGCTTGCACTGTGTGCCTGG - Intergenic
1012768320 6:103397354-103397376 CATAGCTTGCACTGTGTGCCTGG + Intergenic
1013330548 6:109095572-109095594 CTTGGTAAGCACTGTAAGCTGGG + Exonic
1014266430 6:119283388-119283410 CATGCTTAACACTGTATGCCTGG - Intronic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1024027211 7:45422727-45422749 CATAGTTAACAGTGGAAGACTGG - Intergenic
1024524720 7:50338150-50338172 CATAGTCATCACTGCAAGCATGG - Intronic
1026223586 7:68421488-68421510 CAGAGTTTGCACTGTCACCCAGG - Intergenic
1026290039 7:68997979-68998001 CAAAGTTTGCTCTGTCAGCCAGG + Intergenic
1029878024 7:103773942-103773964 CTTATTTAGCACTGTGAGCTAGG + Intronic
1034740788 7:153471625-153471647 TAGAGTGAGCACTGTGAGCCGGG + Intergenic
1035756282 8:2035286-2035308 CTGAGTTAGCACTGTAAGACAGG - Intergenic
1038065180 8:23956361-23956383 CAGAGCTAGAACTGGAAGCCAGG - Intergenic
1043570138 8:81593927-81593949 GATAGTTAACACTGTAGGACAGG - Intergenic
1048074412 8:131053535-131053557 CAAAGTTAACACTGGAACCCAGG + Intergenic
1050227196 9:3473184-3473206 CAAAGTAGGCACTATAAGCCAGG + Intronic
1051988242 9:23117947-23117969 CATAGGTAGCACTGAAAGCCAGG + Intergenic
1056695178 9:88842888-88842910 CAAACTTAGCACTGTGTGCCGGG - Intergenic
1186302123 X:8211766-8211788 CATAGATAGAACAGTAAACCTGG + Intergenic
1192098088 X:68234444-68234466 CATAGCTAGCAATGGAAGGCAGG + Intronic
1193044045 X:77033489-77033511 CATCCTTAGCACTGCTAGCCAGG + Intergenic
1193515998 X:82464669-82464691 CATAGCTAGCTGTATAAGCCTGG + Intergenic
1196011936 X:110898112-110898134 CACAGCTTGCACTGTATGCCTGG - Intergenic
1198529402 X:137535933-137535955 CATAGTTACCACTGTCACCCAGG + Intergenic