ID: 947454511

View in Genome Browser
Species Human (GRCh38)
Location 2:230241593-230241615
Sequence CTGTGTGAGGGGAGGAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 583}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947454511_947454522 29 Left 947454511 2:230241593-230241615 CCAGTCCTCCTCCCCTCACACAG 0: 1
1: 0
2: 6
3: 59
4: 583
Right 947454522 2:230241645-230241667 TGTGAGAGAACCAATGAAAAAGG 0: 1
1: 0
2: 2
3: 28
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947454511 Original CRISPR CTGTGTGAGGGGAGGAGGAC TGG (reversed) Intronic
900129189 1:1080423-1080445 CTGGGTGGGAGGAGGAGGAGGGG + Intergenic
900140368 1:1137188-1137210 CTGAGTGTGCGCAGGAGGACGGG - Intergenic
900478640 1:2887788-2887810 GTGTGGGAGGGGAGCAGGGCTGG + Intergenic
900547520 1:3236949-3236971 CTGTGTGAGGAGAGCTAGACAGG + Intronic
900551581 1:3259147-3259169 CTGTGTGTGGGCAGAAGGGCCGG - Intronic
900569192 1:3350019-3350041 CTTTGAGGGGGGAAGAGGACAGG + Intronic
900649789 1:3725222-3725244 CTGTGTCAGGGGAGAAGGTTGGG + Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
900884944 1:5408536-5408558 CTGGGAGAGGGCAGGAGGAATGG - Intergenic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901185313 1:7369081-7369103 CTGTGGTGGGGGAGGAGGAGGGG - Intronic
901666855 1:10831064-10831086 CTGGAGGAGGGGATGAGGACAGG + Intergenic
902529685 1:17082781-17082803 CAGTGTGAGGGGAGGAGGATGGG - Intronic
902601100 1:17540444-17540466 CTGTGGGAGGAGAGGATGCCGGG + Intronic
902667283 1:17948551-17948573 CAGGGTGAGGGCAGGGGGACAGG - Intergenic
902717671 1:18283577-18283599 CTGTGTAGGGGGAGGGGCACAGG - Intronic
903031586 1:20467634-20467656 CTGAGAGATGGGAGGAGCACTGG - Intergenic
903229538 1:21913490-21913512 CTGTCTGAGGGCAGGTGGACAGG - Intronic
903954050 1:27012710-27012732 GTGGTTAAGGGGAGGAGGACAGG + Exonic
904058327 1:27686736-27686758 CGGGGGGAGGGGAGGAGGCCAGG + Intergenic
904131898 1:28281589-28281611 GTGTGTGAGAGGAGGAGGAGAGG + Exonic
904303657 1:29572945-29572967 CCGTGACAGGGAAGGAGGACAGG + Intergenic
904400484 1:30253579-30253601 CTGGGAGAGGGGAGGTGGCCTGG + Intergenic
904454213 1:30637380-30637402 CTGTGACAGGGAAGGAGGACAGG - Intergenic
904919717 1:33997526-33997548 CTGAGAGAGGGGAGGAAGACAGG - Intronic
904935575 1:34127492-34127514 AGGAGTGAGGGGAGGAGGAGTGG + Intronic
905209959 1:36367231-36367253 GAGGGTGAGGGGAGGAGGCCAGG + Intronic
905316588 1:37085453-37085475 GTTTCTGAGGGGAGTAGGACTGG + Intergenic
905587199 1:39129882-39129904 TTGGGGGAGGGGAGGAGGAGTGG - Intronic
905644232 1:39613595-39613617 CTGCGTGAGGGGAGAAGAAAAGG + Intergenic
905875228 1:41427907-41427929 AGGAGTGAGAGGAGGAGGACGGG - Intergenic
906219697 1:44069026-44069048 TTCTGTGAGGGGAGGGGGTCAGG - Intergenic
906279934 1:44546262-44546284 CTGGGCCTGGGGAGGAGGACAGG - Intronic
907221168 1:52907837-52907859 CTGGGTGTGGGGTGGAGGAGGGG - Intronic
907847132 1:58219190-58219212 CTGTGTGAGGAGGGGAGGAGAGG - Intronic
909392418 1:75132644-75132666 CTGTGTTAGGGAAGCAGGGCGGG - Intronic
911168314 1:94744825-94744847 GTGTGGGAGGGGAGGTGGACAGG + Intergenic
912316297 1:108670211-108670233 CTGTGCCAGGGGATGAGGAAAGG - Intergenic
915141232 1:153769869-153769891 CTGGGAGAGGAGAGGAGGGCAGG + Intronic
915426004 1:155827494-155827516 CTTTGTGAGGGGAGTAGGTGAGG + Intronic
915622643 1:157095322-157095344 CTGAGTGAGGGGTGGAGGTGAGG + Intronic
915895582 1:159808805-159808827 GTGGGTGAGGGTAAGAGGACGGG + Intronic
916890475 1:169107824-169107846 CTGCGTGAGGGAAGGAGGGAGGG + Intronic
917432754 1:174987600-174987622 GTGTGTGAAGAGAGGAGGATGGG + Intronic
917451588 1:175151803-175151825 GTGTGTGAGGAGATGTGGACAGG + Intergenic
917906068 1:179588151-179588173 TGGTGTGAGGGGAGGTGGGCTGG - Intergenic
918095542 1:181330959-181330981 TTGTGGGAAGGGAGGAGGGCAGG + Intergenic
918295137 1:183149504-183149526 CTGTGTGGTGTGAGGAGGAGAGG - Intergenic
919977992 1:202625451-202625473 CAGTGTGCGGGGAGGGGGAAGGG + Intronic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
921075402 1:211696658-211696680 CCCTGTAAGGGCAGGAGGACAGG + Intergenic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922538573 1:226401891-226401913 CTGTGTGGTGGGAGGGGGAGGGG + Intronic
923051784 1:230395107-230395129 GAGTGTGAGGGGAGGAGGGAGGG - Intronic
923051850 1:230395306-230395328 GAGTGTGAGGAGAGGAGGAGAGG - Intronic
923057688 1:230439699-230439721 CTGTGTCAGGGCAGGAGGCAGGG - Intergenic
923689008 1:236175287-236175309 CTGAGTAAGTGGAGGAGGAGAGG + Intronic
924244747 1:242073258-242073280 CCTCCTGAGGGGAGGAGGACAGG + Intergenic
924415111 1:243850165-243850187 CTGTGGGGTGGGGGGAGGACAGG - Intronic
924464684 1:244289598-244289620 CTGTGTGGTGGGAGGTGGATTGG + Intergenic
1062903828 10:1166372-1166394 CTGGGAGAGGGGAGGAGGGGAGG + Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063486586 10:6425993-6426015 CAGAGTGAGGAGAGGACGACTGG + Intergenic
1064150077 10:12855555-12855577 CAGTGAGAGAGGAGGAGGACTGG - Intergenic
1064973495 10:21089630-21089652 CTGGGTAAGGGGGGCAGGACTGG + Intronic
1066566351 10:36725606-36725628 CTGTGAGAAGGAAGGAGGAAGGG - Intergenic
1067441089 10:46309567-46309589 CTGTGTGGAGGGAGGAAGAGAGG + Intronic
1067479460 10:46585475-46585497 CTGTGTGAGGGGTGGGGCCCTGG + Intronic
1067577737 10:47418830-47418852 CTGTGTGGAGGGAGGAAGAGAGG + Intergenic
1067615278 10:47756323-47756345 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1069817169 10:71205509-71205531 CTGTGTAGGGGGATGAGGAAGGG - Intergenic
1069893679 10:71667404-71667426 GTGTGTGAGGGGTGGAGGTGTGG + Intronic
1070161340 10:73868366-73868388 AGGTGGGAGGGGAGGGGGACAGG + Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1070747715 10:78944848-78944870 CTGGGTGAGGGCAGGGGGAAGGG - Intergenic
1070783505 10:79150419-79150441 ATGTGTGGGGGGTGCAGGACGGG - Intronic
1070974833 10:80598068-80598090 CAGTGTGTGGGAAGGAGCACTGG + Intronic
1071415957 10:85441614-85441636 CTTTGTGTGGGGAGAAGGATGGG - Intergenic
1071630679 10:87216274-87216296 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1071648544 10:87374902-87374924 CTGTGTGGGCAGAGGAGGAGAGG - Intergenic
1071669119 10:87590692-87590714 CTGTTTGCGGGGAGGGGGCCTGG - Intergenic
1073047124 10:100646126-100646148 CTGAGGGAGGGGAGGAGGCTGGG + Intergenic
1073077670 10:100834901-100834923 GAGAGTGAGGGGAGCAGGACTGG + Intergenic
1073134408 10:101212192-101212214 CTGTGTGACAGGAGGGGTACTGG - Intergenic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073878840 10:107956119-107956141 CTGTGTGAGAGAAGGAAGCCTGG + Intergenic
1074226318 10:111487956-111487978 CAGAGAGAGGGGAGGAGGATGGG - Intergenic
1075647696 10:124107440-124107462 GGGTGTGAGGGGAGGTGGCCAGG + Intergenic
1075952818 10:126496811-126496833 CTGTGGGCTGGGTGGAGGACAGG - Intronic
1076327985 10:129643227-129643249 CTGTGGGGTGGGAGGAGGGCTGG + Intronic
1076514169 10:131033846-131033868 CTGTGGGAGGGGCTGAGCACTGG - Intergenic
1076762390 10:132611951-132611973 GTGTGGGAGGTGAGGAGGGCAGG + Intronic
1076988642 11:257475-257497 GAGTGTGAAGTGAGGAGGACAGG - Intergenic
1077113018 11:870206-870228 GGCTGTGAGGGGAGGAGGCCTGG - Intronic
1077274103 11:1695376-1695398 CTGTGTGTGGGGTGGGGCACTGG + Intergenic
1077296264 11:1827620-1827642 CTGTGTGAGGTGCGGGGCACAGG + Intergenic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1080532420 11:33189998-33190020 CAGTGTGAGGACAGAAGGACTGG - Intergenic
1080940264 11:36909222-36909244 CTGTGTGAGGTGAGTTGGAAGGG + Intergenic
1081654415 11:44848157-44848179 CTGTGTTAGGGAAGGCTGACAGG + Intronic
1083173632 11:60936607-60936629 CTGTGAGAGTGGGGGAGGAGGGG + Exonic
1083317996 11:61828135-61828157 CTGAGGGAGGGGCGGAGGAAGGG + Exonic
1083445026 11:62702633-62702655 CTGAGAGAAGGGAGGAGGGCAGG - Intronic
1083582266 11:63832590-63832612 CTGTGTGTGGGGTGGAGGTGGGG - Intergenic
1083622582 11:64056423-64056445 CTGCCTGAGGGGAGGAGGGTGGG + Intronic
1083667412 11:64283477-64283499 CTGTGTGGGGTGAGAAGCACAGG - Intronic
1084461782 11:69300298-69300320 GATTCTGAGGGGAGGAGGACTGG - Intronic
1084824791 11:71722030-71722052 CTGTGTGAGGAGTGCATGACAGG + Intergenic
1085150249 11:74246691-74246713 CTGGGTGTGGGGAGGAGAAAAGG - Intronic
1085289079 11:75384511-75384533 CTGTGAAAGGGAAGGAAGACAGG - Intergenic
1085728482 11:78975804-78975826 CTGTGGGAGGGTGGGAGGGCAGG + Intronic
1088598732 11:111457722-111457744 CTGTGGGAGGGAAGGAGGAGGGG - Intronic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088707545 11:112477428-112477450 CTGAGGAAAGGGAGGAGGACAGG - Intergenic
1088861920 11:113808284-113808306 CTGAGTGAGGTGAGAATGACTGG - Exonic
1089157018 11:116410283-116410305 CTGTGGCAGGGAAGGAGGACAGG - Intergenic
1089287069 11:117414426-117414448 CTGTGTGCCAGGAGGAGGATAGG - Intergenic
1089377654 11:118005921-118005943 CTTTGTCAGGCCAGGAGGACGGG + Intergenic
1089672844 11:120068412-120068434 CTGGGTGAGGCGGGGAGGTCAGG - Intergenic
1091105613 11:132916794-132916816 CTCTGTGAAGGGAGGAGGCAGGG - Intronic
1091345186 11:134847585-134847607 ATGTGTGAGGGGAGGGGTCCCGG + Intergenic
1092996932 12:13959475-13959497 CTGTGTGGAGGGTGGAGGAGAGG + Intronic
1094027681 12:25976065-25976087 CTGGGTGAGGAGAGGAGACCAGG - Intronic
1095953070 12:47791857-47791879 CAGTGTGAGGTGAGGAGGCGCGG - Exonic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1096218072 12:49809363-49809385 CGGGGTGAGGGAATGAGGACAGG - Intronic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097899637 12:64859682-64859704 GTTTCTGAGGGGAGGAGGATGGG + Intronic
1099256812 12:80324619-80324641 CTGTTGGAGGAGAGGAGGACAGG + Intronic
1099360127 12:81690493-81690515 GTGTGTTGGGGGAGGAGGAGTGG - Intronic
1099566622 12:84256780-84256802 GTGTGTGAGGGTAGGGGGAGTGG + Intergenic
1099681567 12:85836275-85836297 CAGGGTGAAGGGAGGAGGGCTGG + Exonic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1100542054 12:95566961-95566983 CTGTGTGTGGGGCGGGGGAGAGG - Intergenic
1100565590 12:95790820-95790842 AGGTGCGAGGGGAGGAGGGCTGG - Intronic
1100976301 12:100125629-100125651 CAGAGTGAGGGGAGCAGGGCAGG + Intronic
1101248873 12:102911703-102911725 CTGTGGGTGGGGAGGAAGATGGG - Intronic
1101460771 12:104890987-104891009 GTGTGGGAGGGGAGTAGGATGGG - Intronic
1103190942 12:119001503-119001525 CTGTATGAGTGGAAGAGGGCAGG + Intronic
1103238986 12:119397943-119397965 CTGTGTGGGAGGGGGAGGAAGGG + Intronic
1103512922 12:121487641-121487663 CTGGGTCAGGGTAGGAGGAGAGG - Intronic
1104810391 12:131616957-131616979 CTGTGTCCTGGGAGGCGGACAGG - Intergenic
1104898319 12:132175091-132175113 CTCTGGGAGGTGAGGAGGGCTGG + Intergenic
1105216441 13:18289362-18289384 CTGGGTGAGGGAAGGAACACAGG + Intergenic
1106112981 13:26793104-26793126 CTGCTTTAGGGGAGAAGGACAGG - Intergenic
1106433752 13:29706167-29706189 CTGTGTGTGGGGAGAAGGGGAGG + Intergenic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1106808356 13:33334544-33334566 GGGTGAGAGGGCAGGAGGACCGG - Intronic
1108479442 13:50853638-50853660 CTCTGGGAGTGGAGGAGGGCTGG - Intergenic
1109923211 13:69098337-69098359 CTGGGTGAGGGAGGGAGGATGGG - Intergenic
1110602538 13:77391512-77391534 CTGTGTTAGGAAAGGAGGCCAGG + Intergenic
1112098010 13:96156632-96156654 CTTTGTGTGGGGAAGAGGATTGG + Intronic
1112628279 13:101131510-101131532 ATTTGTGGGGGGAGGAGGATTGG - Intronic
1113636011 13:111919574-111919596 CTGTGTAATGGGAGGATGCCTGG - Intergenic
1113798566 13:113074711-113074733 GTGTGGGAGGGGAGGGGTACAGG - Intronic
1113802238 13:113092659-113092681 CTGTGTGAAGGCAGGAGGCCGGG - Intronic
1113841865 13:113365105-113365127 CTGGGTGAGGCGAGGATCACAGG + Intergenic
1113934520 13:113986686-113986708 GTGAGTGATGGGTGGAGGACAGG - Intronic
1113934973 13:113989178-113989200 GTGAGTGATGGGTGGAGGACAGG - Intronic
1114252243 14:20971447-20971469 GTGAGGGAGGGGAGGAGGGCTGG - Intergenic
1114484378 14:23054369-23054391 CTGTGGGGAGGGAGGAGGGCTGG - Intronic
1116416101 14:44679143-44679165 CTCTGTGAGAGAAGGAGGAAGGG + Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117233477 14:53746451-53746473 CCTTGTGAGGGAAGGAGTACCGG - Intergenic
1117331146 14:54712939-54712961 CTGGAAGAGGGGAGGAGGAAAGG + Intronic
1117460405 14:55939447-55939469 CTGTGTCGGGGGAGGAGGGCAGG + Intergenic
1117517008 14:56511923-56511945 ATGTGTGAAGGGGAGAGGACAGG + Intronic
1118270509 14:64338637-64338659 CGGTCTGCGGGGAGGGGGACGGG - Intergenic
1118480418 14:66159240-66159262 CAATGTGAGGGCTGGAGGACGGG + Intergenic
1118809864 14:69265223-69265245 CTGGGGGTGGGGAGGAGGGCTGG + Intronic
1119526265 14:75324900-75324922 CTGAGTCAGTGGTGGAGGACTGG + Intergenic
1119684082 14:76616426-76616448 CTGTGTTGGAGGATGAGGACTGG - Intergenic
1119686610 14:76637630-76637652 CTGGGTGAGAGGAAGAAGACTGG + Intergenic
1120095270 14:80380990-80381012 GTGTGTGGTGGGGGGAGGACAGG - Intronic
1121361054 14:93260367-93260389 ATGTTTGAGGGAAGGAGGACAGG + Intronic
1121781562 14:96625373-96625395 GTGTGTGAGGGGAGGATGAGGGG - Intergenic
1122092020 14:99347164-99347186 CTGGGTGTGGGGAGGAAGGCGGG - Intergenic
1122206318 14:100149759-100149781 CAGTGGGAGCGGAGGAGGGCGGG - Intronic
1122266374 14:100548765-100548787 GTGTGGGAGGGGAGGACGAAGGG + Intronic
1122793001 14:104192335-104192357 CTGGGTCTGGGCAGGAGGACGGG + Intergenic
1123432112 15:20226786-20226808 GTGTGTGAGGGGTGGAGGGGGGG - Intergenic
1123707949 15:22964261-22964283 GTGTGTGTGGTGAGGAGGAGTGG - Intronic
1124351184 15:28956726-28956748 GGGGGTGAGGGGAGGAGGAATGG - Intronic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124493600 15:30173375-30173397 CAGTGTGCGGGGAGGGGGAAGGG + Intergenic
1124749968 15:32365274-32365296 CAGTGTGCGGGGAGGGGGAAGGG - Intergenic
1125712266 15:41796563-41796585 CTGTGGAAGGGGAGGAGCAGGGG - Intronic
1125722592 15:41852380-41852402 CTGGGGGAGGGGAGGTAGACGGG - Intronic
1126230179 15:46314791-46314813 CTGAGGGAGGGGAGCAGGGCAGG - Intergenic
1126393465 15:48185134-48185156 GTTTGTGAGGGGAAGAGGAAGGG + Intergenic
1128325327 15:66720403-66720425 CTGGGTGAGGGAAGGAGCCCTGG + Intronic
1128759279 15:70204485-70204507 TTGTATGAGGGCAGGAGGAAAGG - Intergenic
1129233375 15:74209075-74209097 GTCTGTGAGGGCAGGAGGAGGGG - Intronic
1129270087 15:74414991-74415013 CTGGGTGAGTGGAGGTGGATGGG - Intronic
1129321515 15:74777605-74777627 CTGGGGGAGGGGAGGAGGCTGGG + Intergenic
1129583575 15:76838476-76838498 CTATGTGAGGGAAGGAGCATAGG - Intronic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1129778347 15:78251991-78252013 AGGGGTGAGGGGTGGAGGACAGG - Intergenic
1130241140 15:82192894-82192916 CTGTGAGAGGGGAGCACTACAGG + Intronic
1130730672 15:86488700-86488722 CTGTTTGAAGCAAGGAGGACAGG - Intronic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131557826 15:93414630-93414652 CAGTGACACGGGAGGAGGACAGG - Intergenic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1133109151 16:3535318-3535340 TTGTGTGAGGGGAGAGAGACAGG + Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133287377 16:4696913-4696935 CGGTGAGAAGGGAGGGGGACAGG + Intronic
1134282304 16:12828099-12828121 TTGTGGGAGAGCAGGAGGACTGG + Intergenic
1134453232 16:14376162-14376184 CTGTGTGAGGGGCACAGGGCAGG + Intergenic
1134665557 16:16015988-16016010 CTGCCTGATGGGAGGAAGACAGG - Intronic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1136561090 16:31039700-31039722 CTGTGGGAGAGGAGGGGGTCAGG - Intronic
1136852526 16:33624353-33624375 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1137555121 16:49465395-49465417 CTGTGTGAGGTGGGGAGAGCTGG + Intergenic
1137626837 16:49914373-49914395 GTGTGTGAGGGATGGAGGAATGG + Intergenic
1137735127 16:50718168-50718190 CTGTGTGATGGGAGGAAGTGAGG + Intronic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138476484 16:57273289-57273311 CTGTGTGAGGGTGGCAGGATGGG - Intronic
1138551904 16:57752995-57753017 CAGTGTGGGGGTAGGAGGAGGGG - Intronic
1138983196 16:62295649-62295671 CTATGTCATGGGAGGAGGAGAGG + Intergenic
1139021983 16:62761111-62761133 CTCTGTGGAGGGATGAGGACGGG - Intergenic
1139323340 16:66133048-66133070 CTGTGTGAGTGGAGCTGGCCTGG + Intergenic
1139446943 16:67003913-67003935 GTGTGGGAGGGGAGCAGGATAGG - Intronic
1141027131 16:80559229-80559251 GTCAGTGAGGGCAGGAGGACAGG + Intergenic
1141036401 16:80630067-80630089 CTGTGTGAGAGGAGGAATACAGG - Intronic
1141347129 16:83256970-83256992 CTGTGTGTTGTGAGGAGGGCAGG + Intronic
1141393233 16:83681760-83681782 CTGTGTGTGCAGAGGAGGAGTGG + Intronic
1141706115 16:85665653-85665675 GTGTGTGAGGGGCCGAGGACTGG - Intronic
1141849034 16:86631436-86631458 CTGGGAGAGAGGATGAGGACGGG - Intergenic
1142229776 16:88894827-88894849 CTGTGTGCGCCGAGGAGGAGGGG + Intronic
1142230021 16:88895713-88895735 CTGTGGGAGGCCAGGAGGGCGGG + Intronic
1203114126 16_KI270728v1_random:1472821-1472843 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1142630146 17:1220351-1220373 CTGTCTGAGGGGAGGCTGCCTGG - Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1142985804 17:3694914-3694936 CTAAGGGAGTGGAGGAGGACGGG + Intronic
1143016131 17:3892266-3892288 CTGCGTGGGGGGTGCAGGACAGG - Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143324574 17:6090437-6090459 CTGTGTGCGGGGCTGTGGACCGG + Exonic
1143572869 17:7771478-7771500 CTGTGTCAGGGCAGGAGCCCTGG - Intronic
1143644847 17:8223507-8223529 CTGGGTGACTGGAGGGGGACAGG + Intergenic
1143859336 17:9876639-9876661 CTGTTTCAGGGGAGAAGGGCGGG + Intronic
1144020856 17:11239797-11239819 CTATGGGAGGTGAGGAGGATGGG - Intergenic
1144644053 17:16957089-16957111 CTGTGCGGGGGGATGTGGACAGG + Intronic
1144670539 17:17130371-17130393 GGGAGGGAGGGGAGGAGGACAGG - Intronic
1144831049 17:18131421-18131443 CTCAGTGAGGGTAGGAGGGCTGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144877888 17:18411837-18411859 CGGTGTGAGGGGAAGAAAACGGG - Intergenic
1145154341 17:20532588-20532610 CGGTGTGAGGGGAAGAAAACGGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145939937 17:28737992-28738014 CTGTGGGAGGTGAGCAGGCCAGG + Exonic
1146262577 17:31431683-31431705 CAGGGTGAGGGTAAGAGGACTGG + Intronic
1146393670 17:32444723-32444745 CTGTGTGAGGGGGGCCGGGCCGG + Intronic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1146762837 17:35493171-35493193 GTGTGTGAGGGGAGGAAGCCAGG - Intronic
1146833193 17:36088404-36088426 CGGTGTGAGGGAAGGGGGAGGGG + Exonic
1147575492 17:41596525-41596547 AGGTGTGAGGGGAGAAGGCCTGG + Intergenic
1147595278 17:41712646-41712668 CCCTGGGAGGTGAGGAGGACTGG + Intronic
1148579704 17:48735047-48735069 CTGTGTAAGGAGGGAAGGACTGG + Intergenic
1148792417 17:50180853-50180875 CTGGGTGGGTGGAGGAGGAGAGG - Intergenic
1148829769 17:50424128-50424150 CTGTGGATGGGGAGGAGGGCTGG - Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149960468 17:61104205-61104227 CTGTGGGTGGGGAGGTGGAATGG - Intronic
1150250540 17:63702012-63702034 GTGTGTGGGGGGGGGAGGGCGGG + Intergenic
1150289132 17:63971665-63971687 GTGGGTGAGGGGAGGGGGCCAGG - Intronic
1150355919 17:64484546-64484568 CTCTATCAGGGGAGGAGGAGTGG + Intronic
1150438874 17:65175697-65175719 AAGTGGGTGGGGAGGAGGACAGG - Intronic
1150663682 17:67109549-67109571 CTGTGCGTGGGGAGCAGGAAGGG + Exonic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151408908 17:73907721-73907743 CTCTGTTGGAGGAGGAGGACAGG + Intergenic
1151473340 17:74331348-74331370 CTGAGTGGGGAGAGGTGGACCGG + Intronic
1151539969 17:74759795-74759817 CAGTGTGGTGGAAGGAGGACAGG + Intronic
1151658786 17:75508012-75508034 CTGAGTGAGGGGAGGGGCCCTGG - Intronic
1152350425 17:79781207-79781229 CTCTGCGAGGGCTGGAGGACAGG + Intronic
1152351258 17:79785137-79785159 CTGGGTCGGGGGAGGAGGAGTGG + Exonic
1152515428 17:80820812-80820834 CTGTGTGGGTGGTGGAGGGCAGG - Intronic
1152624848 17:81383523-81383545 CGGGGTGGGGGGAGGAGGAAAGG - Intergenic
1152723033 17:81932096-81932118 CTGTGTGAGGGGAGCTGGGCTGG - Intergenic
1152762135 17:82114336-82114358 CTGGGTGAGGGGGGAGGGACGGG + Intronic
1152820521 17:82435572-82435594 CTGCCTGTGGGGAGGAGGCCAGG - Intronic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1154074117 18:11182417-11182439 CTGTGTGACAGCTGGAGGACTGG + Intergenic
1154131091 18:11737885-11737907 CAGGGTGAGGGGAGGAGGTCAGG - Intronic
1155327084 18:24675500-24675522 CTGTGTGTGGAGGGGAGGAAGGG + Intergenic
1157529824 18:48410551-48410573 CAGTGCGAGGGGAGGAGGAAGGG + Intronic
1157570894 18:48711596-48711618 CTGTGTCATGGGGGGAGGAAGGG - Intronic
1158004142 18:52652734-52652756 GTGTGTGGGTGGAGGAGGAGTGG + Intronic
1158551046 18:58436632-58436654 CTGAGTGACAGGAGGAGGAATGG + Intergenic
1158671304 18:59476344-59476366 CTGTGGGAAGGGAGCAGTACTGG - Intronic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160624381 18:80192859-80192881 CTGTGTGGAGGGCGGAGGAGAGG + Intronic
1160876948 19:1300804-1300826 CCGTGTGAGGCGAGGGGGACGGG - Intergenic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161509287 19:4661768-4661790 CTGTCTGAGATGAGGAGGCCTGG + Intronic
1162799576 19:13103234-13103256 CTGGGTGAGGAGAGGAGGTGGGG - Intergenic
1162918753 19:13888333-13888355 AGGTGGGAGGGGAGGAGGCCAGG - Intronic
1163149432 19:15402265-15402287 CTGTGTCCTGGGAGGAGGTCTGG - Intronic
1163557240 19:17999713-17999735 CTGGGTGGGGCGAGGAGGCCTGG + Exonic
1163611929 19:18306134-18306156 TTGTGTGTGGGGTGGGGGACAGG - Intergenic
1163744507 19:19037251-19037273 CTGCCTGACGGGAGAAGGACTGG - Intronic
1164883973 19:31761302-31761324 CTGTGTGAGCTAAGGAGGAGAGG - Intergenic
1165355866 19:35303619-35303641 CTCTGTGAGAGGTGGAGGATAGG + Intronic
1165752236 19:38267417-38267439 ATGTGTGAGGGAGGGAGGATGGG + Intronic
1165851357 19:38851945-38851967 CCGCGTGACGGGAGGAGGCCGGG + Intronic
1165959041 19:39519195-39519217 CGGTGGGAGGGGTGGAGGCCGGG + Intronic
1166067259 19:40367059-40367081 CTATGTGTGTGGAGGAGGAGGGG - Intronic
1166825691 19:45607535-45607557 GGGAGTGAGGGGAGGAGGAGAGG + Intronic
1166990973 19:46692537-46692559 CTGTGGGAGGTGAGTAGGAAGGG - Intronic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167234143 19:48303615-48303637 CTGGGTGGAGGGAGGAGGCCCGG - Intronic
1167328750 19:48841130-48841152 AAGGGTGAGGGGAGGAGGGCTGG - Exonic
1167401049 19:49269695-49269717 CTGAGGGAGAGGAGGAGGAAGGG - Intergenic
1167692958 19:50998201-50998223 TTGTCTGAGGGCAGGAAGACTGG - Intronic
1167712836 19:51123016-51123038 CTGTCAGAGGGGTGGAGGCCTGG + Intergenic
1167735827 19:51294032-51294054 CTGTGTGGGGCGAGGGGGCCTGG - Intergenic
1167859317 19:52270124-52270146 CTGTGTTGGGGGAGGTGGCCGGG + Intronic
1168228628 19:55014661-55014683 CAGTGTGCAGGGAGGAGGATGGG + Exonic
1168353019 19:55687282-55687304 CTGTGGCTGGGGAGGAGGATGGG + Intronic
925267816 2:2579391-2579413 CTGTGTGGGGGCAGGATGAGGGG + Intergenic
925364742 2:3304219-3304241 CTGTGCGCGGGGAGGTGGTCTGG + Intronic
925380678 2:3423497-3423519 CTGGGGGTGGGGAGGAGGGCCGG - Intronic
925527341 2:4817554-4817576 CTGTCTGAGGGGATTAGGAAAGG + Intergenic
925758253 2:7156186-7156208 ATGTGTGTGGGGTGGAGGACAGG - Intergenic
925948407 2:8888353-8888375 ATGTGTGAGATGAGGAGGCCAGG - Intronic
926195765 2:10762831-10762853 CTGGGAGGGGAGAGGAGGACAGG - Intronic
926315065 2:11703741-11703763 GTATGTGGGGGGAGGAGGAAGGG - Intronic
926731380 2:16038280-16038302 CTCTGTCAGGGGAGGAGGGAGGG + Intergenic
926791645 2:16577892-16577914 CTGCGGGAGGGGAGGAGCATTGG + Intronic
926969575 2:18453246-18453268 CTGTATGAGGGGTAGAGAACAGG + Intergenic
927847799 2:26480369-26480391 CTGTGAGACGGAAGGAGGCCTGG - Intronic
928020441 2:27700510-27700532 GTGTGTGGGGGGTGGGGGACAGG - Intergenic
928108714 2:28489562-28489584 CTGTACGATGGGAAGAGGACTGG + Intronic
928375240 2:30768420-30768442 CTGGGTGGGAGGAGGAGGAGCGG + Intronic
929045187 2:37782536-37782558 CTGTGTGAGGCGAGGTGGAGTGG - Intergenic
929961085 2:46496798-46496820 CAGTGTGACAGGAGGAGGGCAGG + Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931430542 2:62205729-62205751 CAGTGTGAGAGGAGGAGCGCTGG + Intronic
931450412 2:62363476-62363498 CTGTGTGAGGGGAGTTGGAGGGG - Intergenic
932475498 2:72003370-72003392 GTGTGTGAGGGGCAGAGGCCAGG + Intergenic
932501712 2:72188045-72188067 CTGTGCTGGGGGTGGAGGACCGG + Intronic
932572643 2:72946057-72946079 CTGTGGGGTGGGAGGAGGGCAGG - Intronic
932702628 2:74001993-74002015 TTGTGTGTGTGGAGGAGGGCAGG + Intronic
932731905 2:74227326-74227348 CTGGGTGAGGGGAGGAGCCCTGG + Intronic
934297885 2:91757362-91757384 CTGGGTGAGGGAAGGAACACAGG - Intergenic
934661172 2:96144481-96144503 CTGTCTCAGGTCAGGAGGACTGG - Intronic
934944122 2:98524449-98524471 CTGGGTTGGGGGAGGAGGCCAGG + Intronic
935693366 2:105749719-105749741 CGGTGTGAGGGGAGGCCGGCAGG + Intronic
935735462 2:106103437-106103459 CTGGGTGAGTGGAGGAGGATGGG + Intronic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
937400837 2:121582229-121582251 CAGAGGGAGGGAAGGAGGACAGG + Intronic
937632332 2:124117046-124117068 CTCTGTTAGGAGAGGAGGATAGG - Intronic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
938422692 2:131156943-131156965 CTGCATGAGGTGAGGAGGGCAGG - Intronic
938677876 2:133657222-133657244 ATGGGTGAGGGGAAGAGAACTGG - Intergenic
938692748 2:133807442-133807464 CTATGTGTGGGGAGGATGCCAGG - Intergenic
939333914 2:140800242-140800264 CTGTCATAGGGGAGGAGGAGCGG + Intronic
940367276 2:152862059-152862081 CTGTGTGAGTGTAGGAGGACAGG + Intergenic
941288483 2:163644911-163644933 CTATGGCAGGGGAGGAGGAATGG + Intronic
941930523 2:170934554-170934576 CTGTGTTAGGGGATGAGGTAGGG - Intronic
941998075 2:171620426-171620448 ATGTCTGAGGGAAAGAGGACAGG + Intergenic
942313248 2:174675815-174675837 CTGTGTGTGGGGTGGAGGCGGGG + Intronic
943536783 2:189162080-189162102 CTGCCTGAGAGGTGGAGGACTGG - Intronic
944316144 2:198287584-198287606 CTATGTGTGGGGTGGAGGAAAGG + Intronic
945056041 2:205869772-205869794 CTGGGGGATGGGAGGAGGAAAGG + Intergenic
946181255 2:217950516-217950538 CTGGGGGAGGTGAGGAGGTCTGG + Intronic
946401873 2:219472506-219472528 CTGGGTGAGGAGAGGAGGCACGG + Intronic
946506945 2:220311972-220311994 CAGTGCCAGGGGTGGAGGACTGG - Intergenic
946896457 2:224329005-224329027 CAGGGTGAGGGGAGTAGGAATGG + Intergenic
947213849 2:227732085-227732107 GTGTAGGAGGGCAGGAGGACAGG + Intergenic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
947724293 2:232387743-232387765 GTGTGTGCAGGGAGGGGGACAGG - Intergenic
947729480 2:232420103-232420125 GTGTGTGCAGGGAGGAGGACAGG - Intergenic
947883723 2:233545357-233545379 CTGGCAGAGTGGAGGAGGACTGG - Intronic
948025427 2:234772507-234772529 CTGTGTGGGGGGTGGAGCAGAGG - Intergenic
948066695 2:235086570-235086592 CTATGACACGGGAGGAGGACAGG + Intergenic
948205000 2:236158982-236159004 TTGTGGGAGGGGACGAGGTCAGG + Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948761041 2:240191180-240191202 CTGAATGAGGGGATGAGGAATGG - Intergenic
1168790615 20:573452-573474 CTGTGAGATGGGAGGTGGCCGGG + Intergenic
1168805813 20:671809-671831 CTCTGAGAGGGCAGGAGGGCAGG + Intronic
1168965566 20:1895931-1895953 GGGTGTGAGGGGAGGAGGTGAGG + Intronic
1170564801 20:17592772-17592794 CTGGGAGAGGGGAGGTGGAAAGG - Intronic
1170598918 20:17825972-17825994 CTGTCTTGGGGGAGTAGGACTGG + Intergenic
1171210282 20:23311183-23311205 GAGTGGGAGGGGAGGGGGACAGG - Intergenic
1171306192 20:24108662-24108684 CTGTGGGAGGAGAGAAGGCCAGG - Intergenic
1172986417 20:38994898-38994920 GTTTGTGAGGAGAGGAGGAAAGG - Intronic
1172997606 20:39082812-39082834 GTGTGTGAGGGGATGTGGCCAGG + Intergenic
1173074994 20:39809699-39809721 CAGCGTGAGGGGATGGGGACAGG + Intergenic
1174044547 20:47724242-47724264 CTGTGGGTGGGGAGAAGGAATGG + Intronic
1174102821 20:48140095-48140117 CTGTGGCTGGGGAGGAGGTCTGG - Intergenic
1175372603 20:58502047-58502069 CTGTGAGAGGAGAGGAGAAAGGG - Intronic
1176179039 20:63741039-63741061 ATGTGTGATGGGGGGAGGCCTGG + Intronic
1176221732 20:63972531-63972553 CTGTGTGACCCGAGGAGGAAGGG + Intronic
1178437970 21:32576006-32576028 CTGTGTGTGGGGTGGAGGGCTGG + Intergenic
1178910440 21:36669251-36669273 CAGAGTGAGGGGAGAAGGAAAGG - Intergenic
1179891639 21:44338689-44338711 GTGAGGGAGGGGAGGAGGCCGGG - Intronic
1180094517 21:45549782-45549804 CGGATTGTGGGGAGGAGGACAGG + Intergenic
1180875774 22:19174642-19174664 CTGTGTGAGGTCACTAGGACAGG + Intergenic
1181069467 22:20323537-20323559 GTGTGGGATGGGAGGAGGGCGGG + Intergenic
1181593168 22:23896844-23896866 CTGTGTGAGGGCAGGAGGGTTGG + Intronic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1182287477 22:29256938-29256960 CTGTAAGAGGGGAGGAGGTCTGG - Intronic
1182295527 22:29309572-29309594 CTGTGGGCGGGGAGGCGGGCAGG + Intronic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1182675054 22:32032543-32032565 ATGTGTGAGGAGAGGAGGTGGGG - Intergenic
1182821425 22:33219923-33219945 CTGTGTGAGGGGAGGATTCCAGG - Intronic
1183144533 22:35977827-35977849 CTCTGTGACGGAAGGGGGACAGG - Intronic
1183300540 22:37056935-37056957 ATGTGTGAGGGTTGGGGGACAGG + Intronic
1183357351 22:37366833-37366855 CTGTGTGAGGGCACGTGGAAGGG + Intergenic
1183456631 22:37926578-37926600 CTGGGTGAGGGGGGAAGCACTGG - Intronic
1183749866 22:39713706-39713728 CTGTCTGAGGGGAAGAGGTGGGG + Intergenic
1184035449 22:41915681-41915703 AGGTGTGAGGAGAGGGGGACTGG + Intergenic
1184390979 22:44203184-44203206 CTCTATGAGGGCAGGAGGTCTGG + Intronic
1184571450 22:45327595-45327617 CGCTGTCAGGGGAGGTGGACAGG - Intronic
1184631068 22:45780447-45780469 CAGTGTGGTGGGAGGAGGTCTGG + Intronic
1184896235 22:47408539-47408561 CTGTGTGCTGGCAGGAGGACTGG - Intergenic
1185197642 22:49482296-49482318 GTGTGTGAAGGGAGGCGGCCGGG - Intronic
1185399334 22:50607850-50607872 CAGGGTGAGGGGAGGAGGGGAGG + Intronic
949836302 3:8274152-8274174 TGGGGTGAGGGGAGGATGACAGG - Intergenic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
950103282 3:10371546-10371568 CTGTGTGTGGGCAGGGGGAGTGG + Intronic
950134977 3:10574787-10574809 CTGTGTGGGGGAAGGAGGAGTGG + Intronic
950263559 3:11559300-11559322 CTGTGACAGGTGAGGAGGCCCGG + Intronic
950468280 3:13168653-13168675 CTGTGTGAGGGCAGAATGAAAGG - Intergenic
950951642 3:17006325-17006347 GTGTGGGAGGGAAGGAGAACTGG - Intronic
951168489 3:19510241-19510263 TTGTGGGAGGGAAGGAGCACAGG - Intronic
952481207 3:33763629-33763651 CAGTGTTGGGGGAGGAGGAGAGG + Intergenic
952740038 3:36725963-36725985 CCTTGTTGGGGGAGGAGGACAGG - Intronic
953783494 3:45893111-45893133 GTGTGGGAGGGCAGGAGGGCAGG - Intronic
954224600 3:49173812-49173834 CTCAGTCTGGGGAGGAGGACTGG - Intronic
954444477 3:50539485-50539507 CTGGGAGTGGGGAGGAGGAGAGG + Intergenic
954535256 3:51355037-51355059 CTGGGTGGGAGGAGGAGGGCAGG + Intronic
954625413 3:52019636-52019658 CTGTGTGAGGGGCAGAGGGGTGG + Intergenic
954699091 3:52442301-52442323 CTGTCTGCGGGGAGAAGGAGGGG + Exonic
955770603 3:62381196-62381218 CTGGTTGAGGTCAGGAGGACAGG + Intergenic
957223280 3:77411766-77411788 CTGTTTATGGGGAGGAGAACTGG + Intronic
957835921 3:85589143-85589165 TTGTGTGTGGGGAGGAGGCTGGG + Intronic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
959012030 3:101088847-101088869 CTCTGTGAGGGAGGGAGGAAGGG + Intergenic
959371587 3:105533693-105533715 GGGTGTGAGGGCAGGAGGACAGG + Intronic
961043279 3:123692468-123692490 CTGGGTGTGGGGATCAGGACTGG + Intronic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
961393536 3:126570608-126570630 CTGTGTGAGGGGAGGCAGTGAGG - Intergenic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961549703 3:127662006-127662028 TTGAGTGAGAGGAGGAGGCCAGG - Intronic
961622719 3:128237593-128237615 CTGGGAGAGGGGAGCAGGGCAGG - Intronic
961629231 3:128284114-128284136 TTGTGTGGGGGGTGGAGGGCTGG - Intronic
961895997 3:130168064-130168086 CTGTGTGAGGAGTGCATGACAGG - Intergenic
962610806 3:137074587-137074609 GTGTGTGAGGTGAGGTGGAGTGG + Intergenic
962700680 3:137996926-137996948 CAGTGGGAGGGCAGGAGGAAGGG - Intergenic
962952213 3:140229636-140229658 CTGAGTGAGTGAAGGAGGAAGGG + Intronic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
964421882 3:156511885-156511907 CAATGGGAGGGAAGGAGGACAGG - Intronic
966772001 3:183512244-183512266 TTGCGTGAGGGGAAGAGGAGAGG + Intronic
967135693 3:186510833-186510855 CCGTGTGAGGGGAGTGGTACGGG - Intergenic
967221701 3:187252865-187252887 CTGTGTGAGGGGTAGAGTTCAGG + Intronic
967554808 3:190843627-190843649 CTTTGTGAAGGGAGAAGGAGTGG - Intergenic
967818303 3:193817136-193817158 CTGTGAGGGCGGAGGAAGACTGG - Intergenic
968058911 3:195713301-195713323 AGGAGTTAGGGGAGGAGGACTGG - Intergenic
968059078 3:195713860-195713882 AGGAGTTAGGGGAGGAGGACCGG - Intergenic
968136896 3:196226314-196226336 TTTTTTGTGGGGAGGAGGACAGG - Intronic
968597932 4:1494951-1494973 CTGTGTGAGGGGGACAGGATAGG + Intergenic
968673706 4:1865785-1865807 CTGGCTGTGGGGAGGAGGACAGG - Intergenic
968739494 4:2320126-2320148 GTGGGGGAGGGGAGGGGGACAGG - Intronic
968882295 4:3307600-3307622 CCGAGTGAGGGGAGGAGGGAAGG - Intronic
969359291 4:6651764-6651786 GTGGGTGTGGGGAGGAGCACAGG + Intergenic
969392535 4:6901135-6901157 TTGTGTGGGAGGAGGAGGACTGG + Intergenic
969517068 4:7653808-7653830 CTGTGTGAGGATGGGAGGAAGGG - Intronic
969746771 4:9078902-9078924 CTGTGTGAGGAGTGCATGACAGG + Intergenic
969835053 4:9833749-9833771 GTTGGTGAGGGGAGGAAGACAGG + Intronic
970050124 4:11904999-11905021 CTGTGGGAAGGGAGGATGAAGGG + Intergenic
972316599 4:37932695-37932717 CTCTGTGAGGAGAGGAGCACTGG - Intronic
972327012 4:38026333-38026355 CTGTGGGAGGGGAGGAGCCGTGG + Intronic
972651810 4:41025134-41025156 TTGTGGGAGTGAAGGAGGACCGG - Intronic
973857580 4:55028780-55028802 ATGTCTGAGGGGAGGAGGATGGG - Intergenic
977379953 4:96260088-96260110 CTGGGTGAAGTGAGGAGGATGGG + Intergenic
977571359 4:98632777-98632799 CTGGGGATGGGGAGGAGGACTGG + Intronic
977965448 4:103142053-103142075 GAGTGTGAAGAGAGGAGGACAGG - Intronic
978628824 4:110719296-110719318 CTGTGTTTGCGGAGGAGGAGGGG + Intergenic
980973384 4:139587776-139587798 GTGTTTGTGGGGAGGGGGACAGG + Intronic
981554939 4:145982901-145982923 CTGGGTGAGGGGATGAGTTCTGG - Intergenic
982814283 4:159866602-159866624 CCATGTGAGGTGAGCAGGACAGG + Intergenic
983942310 4:173548009-173548031 CTGTGTGAGTGGAACAGGAATGG - Intergenic
984048275 4:174829986-174830008 ATGTGGGAGGGGAGGAAAACAGG - Intronic
984209669 4:176830425-176830447 TGGGGTGAGGGGAGGAGGAATGG + Intergenic
984943756 4:184955328-184955350 GTGTGTGGAGGGAGGAGGGCAGG + Intergenic
985223389 4:187732041-187732063 CTGAGGGGGAGGAGGAGGACGGG - Intergenic
985859850 5:2462284-2462306 CTGGGGGAAGGGAGGAGGCCAGG - Intergenic
986060764 5:4187999-4188021 CTTTGGGAGAGGAGGAGGAAGGG + Intergenic
986249336 5:6042510-6042532 CTGTGGGTGGGGAGAGGGACAGG + Intergenic
991023177 5:62002229-62002251 GGGTGAGAGGGGAGGAGGAGGGG - Intergenic
991049356 5:62255802-62255824 GTGTGTGAGGGGTGGAGGCGGGG - Intergenic
992896777 5:81252674-81252696 CGCTGTGTGGGGAGGAGGGCAGG - Exonic
995526620 5:113055312-113055334 CAGTGTGAGATGAGGAGGGCAGG - Intronic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
996308670 5:122078420-122078442 GTGTCTGGGGGGAGGAGGGCAGG - Intergenic
996547606 5:124696740-124696762 CTCTGTGAGGTAAGTAGGACGGG + Intronic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998369071 5:141649706-141649728 CTGTGGGTGGGGTGGAGGGCAGG - Intronic
999247097 5:150160884-150160906 CTCTGTGAGGACAGGAGGACAGG - Intergenic
999247795 5:150164545-150164567 CTGAGTCTGGGGAGGAAGACAGG - Intergenic
999288331 5:150407325-150407347 CTGTGGGAGGTGGGGAGGATAGG + Intronic
999443773 5:151622609-151622631 AGGTGTGAGGGGAGGTGGCCAGG + Intergenic
1001233035 5:170006170-170006192 CAGTCTGAGGGGATGTGGACAGG + Intronic
1001477553 5:172061269-172061291 CTGTGGGGAGAGAGGAGGACAGG + Intronic
1001795000 5:174494751-174494773 CTGTGTAAAGGAAGGAGTACTGG + Intergenic
1001857245 5:175023578-175023600 ATGTGTGAGGCGAGGGAGACTGG - Intergenic
1001923046 5:175615810-175615832 GGCTGTGAGGGGAGGAGGATGGG + Intergenic
1002102376 5:176863830-176863852 GTGGGGGAGGGGAGGAGGAGGGG - Intronic
1002327719 5:178420611-178420633 CTCAGGGAGGGGAGGAGGAAAGG - Intronic
1002432278 5:179210582-179210604 GTGGGTGAGGAGAGGAAGACAGG + Intronic
1002558497 5:180063025-180063047 CTGGGGGTGGGGAGGAGGAAGGG + Intronic
1003551894 6:7107889-7107911 CTGTGGGAGAAGAGGAGGAGGGG + Exonic
1004222180 6:13756505-13756527 CTGTTTGAGAGGAGGAAGAGGGG - Intergenic
1004934323 6:20492352-20492374 GTGTGTGAGGGGAGGAGGCCAGG - Exonic
1005009378 6:21321598-21321620 CTGCTTCAGGGGAGGAGGGCAGG - Intergenic
1005099122 6:22150275-22150297 ATGCATGAGGGGAGGAGGGCAGG + Intergenic
1005283780 6:24302772-24302794 CTGTGGGAGGAGTGGAGGGCTGG - Intronic
1005835923 6:29709548-29709570 CTGTGGGAGGAGAGCAGGTCTGG + Intergenic
1005882832 6:30073904-30073926 CTGTGTGATGGAGGGAGGAAGGG - Intronic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006055363 6:31379923-31379945 CTGTGGGAGGAGAGCAGGTCTGG - Intergenic
1006134351 6:31886898-31886920 CTGTGAGGGGGCAGGAGGGCTGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006641059 6:35490159-35490181 CTGCTTGAGGGGAGGCGGGCAGG - Intronic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007633833 6:43286477-43286499 CTGTGGGAGGGAGGGAGGGCTGG + Exonic
1007722992 6:43896700-43896722 CTGTGATAGGGGATGAGGTCGGG + Intergenic
1008680124 6:53863248-53863270 CTATGTAAAGGGAGGAGGGCAGG - Intronic
1009905214 6:69862070-69862092 TTGTCTGATGGGAGGAGGGCAGG + Intergenic
1014821647 6:125995253-125995275 CTTATTGAGGGGAGGAGGAAAGG + Intronic
1015106118 6:129539117-129539139 CTCTGTGAGTGGAGGAGCACTGG + Intergenic
1015882355 6:137881727-137881749 CTGGGGGAGGGGAGGTGGAATGG - Exonic
1016495674 6:144659283-144659305 CTGGGTGAGGGGTGGTGGAAAGG + Intronic
1018953190 6:168392027-168392049 GTGTGCTAGGGGATGAGGACAGG - Intergenic
1018953211 6:168392107-168392129 GTGTGCTAGGGGATGAGGACAGG - Intergenic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1019638972 7:2092556-2092578 GTGTGTGAGGGGAGGATGCTCGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1021272516 7:18608286-18608308 GAGTGGGAGGGGAGGGGGACTGG + Intronic
1021788919 7:24180164-24180186 CTGTGTGACTAGAGGAAGACAGG - Intergenic
1021791284 7:24208304-24208326 CTGGGTGAGAGGAGGAGGGATGG + Intergenic
1022150849 7:27604018-27604040 CTGTCTAAGTGGAGGAGGAGGGG - Intronic
1022440967 7:30432872-30432894 CAGGGTCTGGGGAGGAGGACAGG + Intronic
1022658930 7:32348146-32348168 CTTTATGAGGGAAAGAGGACTGG + Intergenic
1023617053 7:42030220-42030242 CTGTGAGAGGGAAGCAGGAGAGG - Intronic
1023742410 7:43292620-43292642 AGGTGTGAGGAGAGGAGGACTGG + Intronic
1023780565 7:43651525-43651547 CTGGCTGAGGGGAGGCTGACAGG - Intronic
1023967359 7:44969927-44969949 CTGAGTGTGGGGCGGAGGAGGGG - Intronic
1025809465 7:64866264-64866286 CTTGGTGAGGGCAAGAGGACTGG - Intergenic
1026828948 7:73600094-73600116 CGGTGCTAGGGGAGGAGGCCTGG + Intronic
1027926273 7:84467719-84467741 CTGTGTGAAGGCAGGAGGTGAGG - Intronic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029569576 7:101360687-101360709 TTCTTTGAGGGGAGAAGGACAGG + Intergenic
1031001279 7:116418053-116418075 CTGTGTGACGGGAGGAGGAGGGG - Intronic
1031638296 7:124129343-124129365 TTGTGTGTGGGGAGGAGGGGAGG - Intergenic
1032359748 7:131244425-131244447 CTGTGAGAGGGGAGGTGGTGGGG - Intronic
1032505515 7:132431503-132431525 CTGTGAGAGGGAAGGAGGAAGGG + Intronic
1032630538 7:133646035-133646057 CTGTTTGGGGAGAGGAGGAGAGG - Intronic
1032681908 7:134193916-134193938 CTGTGTGGGGGAAGGTGTACAGG - Intronic
1033620057 7:143053787-143053809 GTGAGTGTTGGGAGGAGGACTGG + Intergenic
1033918385 7:146356793-146356815 GTGTTTGAAGGGAGGAGGAAAGG - Intronic
1034256491 7:149727507-149727529 CTCTGTGTGAGGAGGAGGAGGGG - Intronic
1035451507 7:158980060-158980082 CTGTGTGTGGAGCGGAGGTCAGG + Intergenic
1036727119 8:11230274-11230296 GTGTGTGCGTGGAGGAGGAAGGG + Intergenic
1036790162 8:11711949-11711971 CAGTGTGGTGGGAGGAGCACAGG + Intronic
1036821990 8:11948267-11948289 CTGTGTAAGTGGAGGAGGAGAGG - Intergenic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037700209 8:21267070-21267092 CTCTGTCAGGGGAGGATGACAGG - Intergenic
1037770045 8:21793285-21793307 CTGTGTGAGGGATGGAGACCAGG + Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038513522 8:28162931-28162953 CTGCGTCAGGGGAGAAGGAAGGG + Intronic
1039485624 8:37907559-37907581 CTTTTGGAGGGGAGGGGGACTGG - Intergenic
1039594584 8:38779659-38779681 CTGTATGTGGGGAAGAGGAGAGG + Intronic
1041687018 8:60653175-60653197 GTGTGTGAGGGAGGGAGGGCTGG + Intergenic
1041898791 8:62957940-62957962 CTGTGTGAGGGCAGGAACAGGGG + Intronic
1041989938 8:63974973-63974995 GTATGTGAGGGGAGGAGTTCCGG - Intergenic
1042426624 8:68656695-68656717 CATTGTGAGAGGAGGAGGAAAGG - Intronic
1042935776 8:74056686-74056708 TTGTGTGTGAGGAGGAGAACTGG + Intergenic
1044391874 8:91661418-91661440 ATGTGTGATGGGTGGAGGACAGG + Intergenic
1045052844 8:98342518-98342540 CGGTGTGGGAGGAGGAGGAGAGG + Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1046738740 8:117806293-117806315 AAGTGACAGGGGAGGAGGACAGG - Intronic
1046911449 8:119631890-119631912 CTGGGTGTAGGGAGAAGGACAGG - Intronic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048645343 8:136413660-136413682 GTGTGTGAGGGAAGGTGGAAGGG - Intergenic
1048964330 8:139604407-139604429 CTGTGGGACGGGAGGAGGTGGGG + Intronic
1049406897 8:142455636-142455658 CTGAGTGAGGAGTGGGGGACAGG - Intronic
1049638846 8:143705328-143705350 CTGTGTGTAGGGAGGTGCACGGG + Intronic
1052287722 9:26805839-26805861 GTGTGTCAGGGGACGAGGACTGG - Intergenic
1052796928 9:32931462-32931484 CTGTGTGAGGCCAGGAGGGAGGG - Intergenic
1053348546 9:37395994-37396016 GTGTGGGAGGGGAGGGGGCCGGG - Intergenic
1053562171 9:39208063-39208085 CTGACTGTGGGGAGGAAGACGGG - Intronic
1053827977 9:42046064-42046086 CTGACTGTGGGGAGGAAGACGGG - Intronic
1054134947 9:61410895-61410917 CTGACTGTGGGGAGGAAGACGGG + Intergenic
1057793884 9:98142417-98142439 CTGTGTGCAGGAAGGAGGCCAGG - Intronic
1058437304 9:104974876-104974898 CTGGGGGCGGGGAGGAGGATAGG + Intergenic
1058947317 9:109869875-109869897 GTGGGTGAGGTGGGGAGGACTGG + Intronic
1059033789 9:110731434-110731456 CTTTGAGAAGGGAGGAAGACTGG + Intronic
1059123700 9:111663674-111663696 CTGTTTGAGGGGAAGAAGTCAGG + Intronic
1060576948 9:124704743-124704765 TTGTGTGTGGGGGGGAAGACAGG + Intronic
1060589433 9:124807762-124807784 CTGCCTGTGGGGAGGAGGGCAGG - Exonic
1060985844 9:127818513-127818535 CTGGGGCAGAGGAGGAGGACAGG + Intronic
1061290590 9:129648691-129648713 GGGTGTGGGGGGAGGAGGAAAGG - Intergenic
1061527307 9:131176870-131176892 CTGTTTCAGGGGTGGAGGACAGG - Intronic
1061719118 9:132540820-132540842 CTGCTTGAGGGGAGAAGGGCAGG + Intronic
1061753723 9:132798459-132798481 CTGTCTGAGAGGAGGAGAAAGGG - Intronic
1062096367 9:134706022-134706044 CTCTGCCAGGGGAGGAGGACAGG - Intronic
1062357059 9:136170038-136170060 CTGGGTGAGACGGGGAGGACAGG + Intergenic
1062574757 9:137200858-137200880 CTATGGCAGGGGAGGAGGGCGGG + Intronic
1203773293 EBV:60037-60059 CTGGGTGCGGGGATGAAGACAGG + Intergenic
1185459517 X:328291-328313 CGGGGAGAGGGGAGGGGGACGGG - Intergenic
1185652599 X:1659935-1659957 GTGTGTGAGAGGAGGGGCACAGG + Intergenic
1187128956 X:16482229-16482251 GGGTGTGGGGGGAGGGGGACTGG + Intergenic
1187468849 X:19550715-19550737 CTGTGTAAGGACAGGATGACTGG + Intronic
1187477670 X:19626425-19626447 CATTGTGAGGGGAAGAGGACAGG + Intronic
1187626500 X:21120645-21120667 CTGTGTGTGTGGAGGAGCAGAGG - Intergenic
1189322407 X:40094840-40094862 CTGTGTGGGAGGCGGAGGCCAGG + Intronic
1189333136 X:40155054-40155076 CTGCGGGAGGGGAGGGGGTCGGG + Intronic
1189882919 X:45510766-45510788 CTGTGTGTGGGTAGGGGGATAGG - Intergenic
1190735203 X:53251175-53251197 CTGTGCAAGGGGGGGAGGAGAGG + Intronic
1190735994 X:53256329-53256351 CTGTGAGGGGTGAGGAGGACTGG - Intronic
1190909729 X:54759657-54759679 CTGTGAGAGTTGAGGAGGATGGG + Intronic
1192177594 X:68895515-68895537 CAGTGGGAGGGGAGTGGGACAGG + Intergenic
1192185504 X:68944265-68944287 CTGTGTGTGGGGATGAGTGCAGG + Intergenic
1194250729 X:91571639-91571661 CTGTGTGTGGGGTGGAGGTGAGG + Intergenic
1194959969 X:100223903-100223925 CTGTCTGAGGAGGGGAAGACTGG - Intergenic
1195175298 X:102309201-102309223 CTGAATAAAGGGAGGAGGACAGG + Intronic
1195183567 X:102377892-102377914 CTGAATAAAGGGAGGAGGACAGG - Intronic
1195742119 X:108075473-108075495 TTGTGTGAGGGGAGGCAGATGGG + Intronic
1195989449 X:110668104-110668126 CTTTGTAAGGGGAGAAGGCCTGG + Intergenic
1196894410 X:120320861-120320883 CTGGGTGAGAGGAGGCAGACAGG - Intergenic
1197447300 X:126566031-126566053 TGGGGTGAGGGGAGGGGGACGGG + Intergenic
1197656925 X:129126823-129126845 TTGTGTGTGGGGAGGAGTAGGGG - Intergenic
1198157075 X:133971670-133971692 GGGTGTGAGGGTAGGAGGAAGGG + Intronic
1198960145 X:142174783-142174805 CTGGGTGAGGGGTGGAGGGGAGG - Intergenic
1199721130 X:150543423-150543445 CAGTGTGAGGGAGGGAGGATGGG + Intergenic
1200110594 X:153738849-153738871 CTGTGTGCAGGGAGGAGGCCAGG - Intronic
1200154974 X:153970463-153970485 CGGGGAGAGGGGAGAAGGACGGG + Intronic
1200569673 Y:4812885-4812907 CTGTGTGTGGGGTGGAGGTGAGG + Intergenic
1202035149 Y:20625547-20625569 GTGTGTGTGTGGAGGAGGAGGGG + Intergenic