ID: 947457406

View in Genome Browser
Species Human (GRCh38)
Location 2:230267876-230267898
Sequence CCTCATCAAAACCTTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947457406_947457413 19 Left 947457406 2:230267876-230267898 CCCTCATGAAGGTTTTGATGAGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 947457413 2:230267918-230267940 CCGAACATCTTTGCACAGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947457406 Original CRISPR CCTCATCAAAACCTTCATGA GGG (reversed) Intronic
900384510 1:2403818-2403840 CCTCATGCAACCCTCCATGAGGG + Exonic
900900928 1:5515372-5515394 CAACACCAAAACCTTCATGAGGG + Intergenic
903690741 1:25171649-25171671 CCTGACAAAAACCTCCATGAGGG + Intergenic
905472085 1:38200762-38200784 TCTCAACATAACCTTCATCAAGG - Intergenic
908396203 1:63727915-63727937 CCTCACCAAGATGTTCATGAGGG - Intergenic
908800136 1:67871629-67871651 CTTCATCAAAACACCCATGATGG + Intergenic
909012284 1:70348143-70348165 AGTCACTAAAACCTTCATGATGG - Intronic
912087964 1:106033782-106033804 GGTCATCAGAACATTCATGAGGG + Intergenic
914357410 1:146898815-146898837 CATCATCAAAACCATCGAGATGG + Intergenic
914926441 1:151892878-151892900 CATCCTCAAACCCTTCATGTTGG - Intronic
915873782 1:159590225-159590247 CAGCACCAAAACATTCATGAGGG - Intergenic
917457640 1:175199182-175199204 ACTCATGGAAACCTTCCTGATGG + Intergenic
920587553 1:207181937-207181959 TCTCCACAAAAACTTCATGATGG + Intergenic
922073397 1:222218268-222218290 CAGCACCAAAACATTCATGAAGG - Intergenic
922539350 1:226407617-226407639 CATCAGCAAAACCTTCCGGAAGG + Intronic
922680021 1:227586833-227586855 CCTGATCACCACCTTGATGAGGG - Intronic
1064335437 10:14436377-14436399 TCTCATAAAAACCTCAATGATGG - Intronic
1064470546 10:15630993-15631015 CCCCATCAAAAAGTGCATGAAGG - Intronic
1065264041 10:23956851-23956873 CAGCATCAAAACATTCATGAAGG + Intronic
1066255964 10:33679164-33679186 GCTGATGAAAACCTTGATGAAGG - Intergenic
1068073837 10:52229439-52229461 CCTCCTCAAAGCCATCATGAGGG - Intronic
1068100603 10:52547827-52547849 CAGCACCAAAACATTCATGAGGG + Intergenic
1068365346 10:56042286-56042308 CATCATCAATCCATTCATGAGGG + Intergenic
1069448843 10:68499674-68499696 CTTCATCAAAACCTTTCGGATGG - Intronic
1074917673 10:117972829-117972851 CCTCATCAAGAACTTCAGGCTGG - Intergenic
1077031068 11:467834-467856 CCACATAAAAACCTGCATGCAGG + Intronic
1081501843 11:43674746-43674768 CCACATCAAAGCCTTCATTCCGG + Intronic
1082921240 11:58496685-58496707 CCTCCTCAAATACTTCCTGATGG - Intergenic
1083108857 11:60385521-60385543 CCTCATCAAAGCCTCAAAGAGGG - Intronic
1086043381 11:82504704-82504726 TCTCATTAATACATTCATGACGG - Intergenic
1086331380 11:85757663-85757685 CCGCTGCAAAACCTTCATGATGG + Exonic
1087090746 11:94269966-94269988 CCCCATCAAAAAGTACATGAAGG + Intergenic
1087495917 11:98890645-98890667 CCTCATGAAAACCTCCACTAGGG - Intergenic
1090451345 11:126809145-126809167 CTTCAGCAAAACCTTCATTAAGG + Intronic
1090584534 11:128196621-128196643 AGTAATGAAAACCTTCATGAAGG + Intergenic
1093167295 12:15819303-15819325 CATCATCAAAACATTCAAGGAGG - Intronic
1093343487 12:18009243-18009265 CCTCATGGAAACCTTCACAATGG + Intergenic
1095325370 12:40885255-40885277 CCTCACAAAAACCTTCATATAGG - Intronic
1095391772 12:41715712-41715734 CCTTATCATTACCTTCGTGAAGG - Intergenic
1095651916 12:44621016-44621038 CCTCATTAAAGCTTTCATCATGG + Intronic
1099261001 12:80382599-80382621 GCTCATCAAGGCATTCATGAGGG - Intergenic
1099535801 12:83842783-83842805 CCTCATCATAGCCCTCATAATGG + Intergenic
1100442608 12:94630353-94630375 CCTCATAAAAACCTAAATGTAGG - Intronic
1101471848 12:105004656-105004678 CCTCATTAAACCCATCTTGATGG - Intronic
1105576806 13:21661450-21661472 CCGCATTAATCCCTTCATGAGGG + Intergenic
1108069688 13:46615611-46615633 CTTCATCAAGATATTCATGATGG + Intronic
1108603903 13:52017979-52018001 CCTCCTCAAATCCTTTATAAAGG + Intronic
1111513445 13:89296642-89296664 CATCATTAATACGTTCATGATGG - Intergenic
1112334484 13:98502552-98502574 CCACATTAATACATTCATGAGGG - Intronic
1113128689 13:107009830-107009852 TCTCATAAAAACATTCATTAAGG - Intergenic
1117962623 14:61178249-61178271 GCTCATCAAAACCTGCACAAAGG - Intergenic
1118993055 14:70813019-70813041 CCTCCTCAAAAACTTCATAGTGG - Intergenic
1120397624 14:83987911-83987933 ACTCATAAATAGCTTCATGATGG - Intergenic
1120637439 14:86969538-86969560 TCTCATGAAAGCTTTCATGAGGG + Intergenic
1124473060 15:30005592-30005614 TCTCATTAAAACCTTGTTGAGGG - Intergenic
1124893167 15:33751557-33751579 CCTCATCAAAAACTGGGTGAAGG - Intronic
1125892516 15:43276926-43276948 CCTCACCAACACCTTAATGGTGG - Exonic
1127353553 15:58176099-58176121 CCTCATAAGTAACTTCATGAAGG - Intronic
1128527034 15:68419498-68419520 CCTCATCCACAGGTTCATGAGGG - Intronic
1130169012 15:81492637-81492659 CCACATCAATACCTTTATTAAGG + Intergenic
1130771903 15:86932739-86932761 CTTCAGCAAAACATTCATAATGG - Intronic
1135196050 16:20395705-20395727 CAGCATCAAAACATTCATGAGGG - Intronic
1139109940 16:63877722-63877744 CCTCAGGAAAAGCTTCATGTTGG + Intergenic
1139976778 16:70818479-70818501 CATCATCAAAACCATCGAGATGG - Exonic
1140199082 16:72879889-72879911 CCTCACCGAAACCTTCTTGCTGG - Intronic
1141306673 16:82871057-82871079 CAGCATCAAAAACTTCAAGATGG - Intronic
1142877164 17:2858238-2858260 CCTCCTCATAAACTCCATGATGG - Intronic
1143754462 17:9056365-9056387 CCCCATCAAAACCATCAAGATGG - Intronic
1144991916 17:19238567-19238589 CCTCATCTGAACCCTAATGATGG - Intronic
1152371987 17:79894404-79894426 CCTCATCAAAATCATCATCATGG + Intergenic
1155457660 18:26036785-26036807 CCTCATAAATACCTACATGAAGG + Intronic
1156509347 18:37622782-37622804 TCTCATAAAAACATGCATGAGGG + Intergenic
1157300565 18:46476144-46476166 CCTCATCATAACCTACAAGGTGG + Intergenic
1157898716 18:51492979-51493001 CCTCATCTAAACTCTCATAACGG + Intergenic
1158855861 18:61542915-61542937 CTGCACCAAAACATTCATGAGGG + Intronic
1160018315 18:75160870-75160892 CCTCATCATACTCATCATGATGG - Intergenic
1164938993 19:32237041-32237063 CTTCCTCAAAACCTTCTGGAAGG - Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925582487 2:5425472-5425494 CTTCATCAAAAGTTTGATGACGG + Intergenic
925657555 2:6165971-6165993 CCTCAGCAAACCCTGCATGGTGG - Intergenic
929786646 2:44998306-44998328 CATCATCTAGACCTCCATGATGG + Intergenic
930437845 2:51368858-51368880 CCTCAGAAAAGGCTTCATGAAGG + Intergenic
932841055 2:75082747-75082769 CCCCATCAAAAAGTGCATGAAGG - Intronic
932920209 2:75905230-75905252 TCTCATAAAGACATTCATGATGG + Intergenic
937379911 2:121367275-121367297 CTACAGCAAAACCTTCCTGATGG + Intronic
937404773 2:121616888-121616910 CTTCATCAAGGCCTTCAAGAAGG + Intronic
938935784 2:136126409-136126431 CCTAATCTAAACCTGCATGGGGG - Intergenic
942517334 2:176767735-176767757 CTTCTTCAAAACCTTTCTGATGG + Intergenic
942907285 2:181199324-181199346 CATCATCAAAGCCTTCTAGAAGG + Intergenic
943743138 2:191432936-191432958 CTTCATGAACACCTACATGATGG + Intergenic
944706783 2:202297417-202297439 CCTCACCAAAAGCATCATAACGG - Exonic
945291852 2:208134822-208134844 CCTCAGCAAGCCCTTCCTGAAGG + Intergenic
945352600 2:208800223-208800245 CTTCATGAAATTCTTCATGAAGG - Intronic
945369443 2:208998984-208999006 TCTCATACAAAACTTCATGAGGG - Intergenic
947457406 2:230267876-230267898 CCTCATCAAAACCTTCATGAGGG - Intronic
1169213317 20:3779337-3779359 CCTCTTCAGTACCTTCCTGAGGG + Exonic
1170339159 20:15304040-15304062 CCTCACCACAAGCTTCTTGAAGG + Intronic
1171016797 20:21549277-21549299 GCCCATCAAAACCTTCTTAAAGG + Intergenic
1171057560 20:21922178-21922200 CCTCATGATAAACTTAATGATGG - Intergenic
1173538929 20:43837119-43837141 ACCCATCAAAGCCTTCATGGGGG + Intergenic
1173941137 20:46912535-46912557 CCTAAACAAAAGCTCCATGAGGG - Intronic
1174288867 20:49492748-49492770 CCTCATCAAAGCCTTGGAGATGG - Intergenic
1177310540 21:19386677-19386699 CCTCCTCAAAATATTCATGTAGG + Intergenic
1178968600 21:37148988-37149010 CCACATCAAAACTTTCAAGTGGG - Intronic
1182154800 22:28061042-28061064 CCTCATCAAAAAGTGGATGAAGG - Intronic
1182925037 22:34114306-34114328 CCTGACCATAAACTTCATGAAGG - Intergenic
950802050 3:15560459-15560481 ACTCATCAAACATTTCATGAGGG + Intergenic
951946163 3:28139051-28139073 CTGCATGAAAATCTTCATGATGG + Intergenic
954431514 3:50473243-50473265 CCTCACCATAACCCCCATGAGGG - Intronic
955783949 3:62516171-62516193 TTTCATCAAAACCTTCAAGTAGG + Exonic
955831643 3:63010879-63010901 CCCCATCAAAAAGTACATGAAGG - Intergenic
957299197 3:78368938-78368960 CCTTATCAAAACCTTAATCAAGG + Intergenic
958526000 3:95260177-95260199 CCTCATCGAAACCTTCACTTTGG + Intergenic
960169434 3:114441461-114441483 CACTATCAAAACCTTCATCAAGG + Intronic
961147809 3:124610138-124610160 CCTCACTAAAAGCTCCATGAAGG - Intronic
962849491 3:139297428-139297450 CCTCACCACAAGCTTCTTGAGGG - Intronic
962856613 3:139351924-139351946 CCCCATCAGAACCTTCATTTAGG + Intronic
967801279 3:193663495-193663517 CCTCAAAAAAAGCATCATGAAGG - Intronic
969224060 4:5782907-5782929 TCTCCTCAAAACCATCATTAGGG - Intronic
969257182 4:6010240-6010262 CCTCATCATTACCATCCTGAGGG - Intergenic
969989709 4:11249536-11249558 ACTCAACAAATCCTTCATGGAGG - Intergenic
970343046 4:15126903-15126925 CCTGATCATAATATTCATGAAGG - Intergenic
971279107 4:25226648-25226670 TCTCATCGAAATCTTCATGAAGG + Intronic
971911744 4:32803513-32803535 CTTCTTCATAACCTTCCTGAGGG - Intergenic
973017480 4:45159272-45159294 CCTGATCAAGTCCTTGATGATGG - Intergenic
976542619 4:86295473-86295495 CTACATTATAACCTTCATGAAGG + Intronic
977320404 4:95507636-95507658 CCTGATCACAACCATCATGTTGG + Intronic
981662252 4:147181978-147182000 CATCATCAAAATTTTGATGATGG + Intergenic
987127825 5:14831283-14831305 CCTCATACAAACATTCATGATGG - Intronic
987190075 5:15468410-15468432 CCACTTCAAAAACTTAATGAAGG - Intergenic
988499175 5:31769801-31769823 GCTCATCAACACCATCTTGATGG + Intronic
988637270 5:32998262-32998284 CAGCATCAAGACATTCATGAGGG - Intergenic
989459970 5:41685866-41685888 CCTCATAAAAGCCTTCAGGCTGG - Intergenic
993326192 5:86540365-86540387 CCTGATCAAAATCATCATAAGGG - Intergenic
995267976 5:110186942-110186964 CCTCATCAAAAAGTACATGAAGG - Intergenic
998456389 5:142277082-142277104 CCTCATCATAACCTCCAGAAGGG - Intergenic
1000426385 5:161095931-161095953 CCTCATACAACCCTTAATGAGGG + Intergenic
1000882463 5:166714015-166714037 CCGCATCAAGCCATTCATGAGGG + Intergenic
1001172092 5:169429066-169429088 CCAGAACAAAGCCTTCATGAAGG + Intergenic
1006422290 6:33942614-33942636 CGGCACCAAGACCTTCATGAGGG - Intergenic
1007294935 6:40814496-40814518 CCTCAACCCAACCTCCATGAAGG + Intergenic
1014893747 6:126873969-126873991 CATCATCAATCCATTCATGAAGG - Intergenic
1015295726 6:131590094-131590116 CCTCTTCTCAACCTTCATGATGG + Intronic
1016046207 6:139483332-139483354 CCTCAGCAAAAGCTACAGGATGG + Intergenic
1016616777 6:146058987-146059009 CCTCTCAAAGACCTTCATGAAGG + Intronic
1016725566 6:147361782-147361804 CCTCATCAAAACTTTAAAGGCGG + Intronic
1017273608 6:152539054-152539076 CCTGATCAAAACCTGCTTGTAGG + Intronic
1019137529 6:169920361-169920383 TGTCATCAAAACCTTCATCCTGG + Intergenic
1020414404 7:7929493-7929515 CCTCTTCACAAACTACATGATGG - Intronic
1021606695 7:22415399-22415421 CAGCACCAAGACCTTCATGAAGG - Intergenic
1024537851 7:50452765-50452787 CATCATCAAAATTTTCATGATGG + Intronic
1027989942 7:85345326-85345348 CAGCATCAATCCCTTCATGAGGG + Intergenic
1030003938 7:105096577-105096599 CCACAACATAAACTTCATGAGGG + Intronic
1031620017 7:123924475-123924497 CCTCATTATGACCTCCATGATGG + Intergenic
1033628739 7:143136266-143136288 CCTCCCCAGACCCTTCATGAAGG + Intronic
1035235911 7:157497665-157497687 CCACATCTAGACCTTCCTGACGG + Intergenic
1035341052 7:158162270-158162292 CCACACAAAAACCTGCATGAGGG + Intronic
1036225204 8:6952015-6952037 CCTCAAAAACCCCTTCATGAGGG - Intergenic
1036235978 8:7039922-7039944 CCTCAAAAACCCCTTCATGAGGG - Intergenic
1037387326 8:18357290-18357312 TCTCATCAAACCCTTCTTCAGGG + Intergenic
1038920904 8:32082951-32082973 CCTCATCAAAAACTAAATAAAGG + Intronic
1040670202 8:49680527-49680549 CCTCATCAAGCCCTTTATAATGG - Intergenic
1042333054 8:67602610-67602632 TCTCATCAAGTCCTGCATGAAGG + Intronic
1043296617 8:78671235-78671257 CAACTTCAAAACCTGCATGATGG - Intronic
1043318512 8:78951435-78951457 CCTCATCAAAAAGTGGATGAAGG + Intergenic
1045976919 8:108139767-108139789 CGTCATCAAAACCTGCCTGCTGG + Intergenic
1046679620 8:117154186-117154208 CCTTATCAATACCTAGATGATGG - Intronic
1047959413 8:129999927-129999949 CCTCATCAAAACCTTATGGGAGG - Intronic
1048057897 8:130886106-130886128 CTTCATTTTAACCTTCATGAAGG + Intronic
1048740885 8:137559404-137559426 CCTCATCAAAAAGTTGGTGAAGG - Intergenic
1050054290 9:1635814-1635836 GCTCATCAATTCCTTAATGATGG + Intergenic
1052231232 9:26156117-26156139 CCTAATCAAGAACTTCTTGAAGG + Intergenic
1052434202 9:28405486-28405508 CCTCACCAATTCCTTCATGTAGG + Intronic
1053449854 9:38184309-38184331 CTTCATCAAGCCATTCATGAAGG + Intergenic
1059743469 9:117178190-117178212 ATTCATAAAAACATTCATGAAGG - Intronic
1060167010 9:121425749-121425771 CCACACCAAGACATTCATGAGGG + Intergenic
1060276376 9:122186039-122186061 CCTCCACAAAGCCTTCATTACGG - Intronic
1060284117 9:122233829-122233851 CCACATCAAATTCTTTATGAAGG + Intergenic
1185612991 X:1403107-1403129 CCTCATCAAAACCCCTATGGAGG + Intergenic
1188656032 X:32696594-32696616 CCTCATCACCACCTTCATTAAGG - Intronic
1189159642 X:38798914-38798936 TCTCAACTAAACCTTCATGACGG + Intergenic
1190741399 X:53291172-53291194 CCCCATCAGAAGCTTCATGAAGG - Intronic
1191691234 X:63940592-63940614 CCTCATCAAAAAGTTTGTGAAGG + Intergenic
1196941643 X:120782647-120782669 CTTCATCAAAACCAGCAAGAGGG - Intergenic
1200889348 Y:8306519-8306541 CCTCATCAAAAAGTTGGTGAAGG - Intergenic
1201689559 Y:16747859-16747881 CGTCATCAAAAACTGTATGAAGG - Intergenic
1202165671 Y:21985029-21985051 CCTCATCAAAACGTGGACGAAGG - Intergenic
1202225687 Y:22601343-22601365 CCTCATCAAAACGTGGACGAAGG + Intergenic
1202317426 Y:23594318-23594340 CCTCATCAAAACGTGGACGAAGG - Intergenic
1202553339 Y:26075740-26075762 CCTCATCAAAACGTGGACGAAGG + Intergenic