ID: 947463585

View in Genome Browser
Species Human (GRCh38)
Location 2:230323170-230323192
Sequence CGGGCTGAACAGAGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947463575_947463585 -10 Left 947463575 2:230323157-230323179 CCCCCGCCCCTCACGGGCTGAAC No data
Right 947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG No data
947463572_947463585 13 Left 947463572 2:230323134-230323156 CCAGGAGAAGTGAAGGGCAGAGT No data
Right 947463585 2:230323170-230323192 CGGGCTGAACAGAGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947463585 Original CRISPR CGGGCTGAACAGAGGGCAGG CGG Intergenic
No off target data available for this crispr