ID: 947464238

View in Genome Browser
Species Human (GRCh38)
Location 2:230326837-230326859
Sequence TGCTCTGCCCTCTTAAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947464238_947464244 1 Left 947464238 2:230326837-230326859 CCCCCTCTTAAGAGGGCAGAGCA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 947464244 2:230326861-230326883 CTAAGGACTATTTTGGTTCAAGG 0: 1
1: 1
2: 1
3: 10
4: 133
947464238_947464243 -6 Left 947464238 2:230326837-230326859 CCCCCTCTTAAGAGGGCAGAGCA 0: 1
1: 0
2: 0
3: 15
4: 158
Right 947464243 2:230326854-230326876 AGAGCAGCTAAGGACTATTTTGG 0: 1
1: 1
2: 1
3: 9
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947464238 Original CRISPR TGCTCTGCCCTCTTAAGAGG GGG (reversed) Intergenic
901561890 1:10078679-10078701 TGTTGTGACCTCTGAAGAGGAGG + Intronic
901722916 1:11214837-11214859 TACTCTGCCTTCTTTAGAGAAGG + Intronic
902217384 1:14943111-14943133 TCCTCTGCTCTCCTTAGAGGCGG + Intronic
902649142 1:17825413-17825435 TGTTCTTCCTTCTAAAGAGGCGG + Intronic
903595399 1:24490185-24490207 AGCTCTGCCCTGTGGAGAGGTGG - Intergenic
905207058 1:36348963-36348985 TGCTCTGCTCCCTGGAGAGGGGG - Intronic
905233318 1:36529191-36529213 TGCTCTGTCCTCTGAGGAAGGGG + Intergenic
905743130 1:40389649-40389671 TCCTCTGCCCTCTCAGTAGGAGG + Intronic
906223819 1:44104533-44104555 TGCTGAGCCCCCTTAGGAGGTGG - Intergenic
906949312 1:50321762-50321784 TGCTATGCTCTCTTAGGATGTGG - Intergenic
910843543 1:91584385-91584407 TCCTCTGCCTTCCTCAGAGGAGG + Intergenic
912472218 1:109913541-109913563 TTCTCTGCCATGATAAGAGGTGG + Intronic
912722034 1:112028469-112028491 TGCTTTGGGCTCCTAAGAGGTGG + Intergenic
913036247 1:114969219-114969241 TCCTCTGCTCTCTTCAGAGCTGG + Intronic
913696661 1:121332948-121332970 TGCTCTGCCCCCTTAAGAAAGGG + Intronic
914140899 1:144947112-144947134 TGCTCTGCCCCCTTAAGAAAGGG - Intronic
915571525 1:156747503-156747525 TGCTTCCCCCTGTTAAGAGGAGG - Intronic
915916146 1:159942074-159942096 GGGTCTCCCCTCTGAAGAGGAGG + Intronic
916228898 1:162519201-162519223 TGCTCAGCCCCCTGAAGAGCTGG - Intronic
916257015 1:162799059-162799081 TGCTCTACCTCCTTAAGAGTGGG + Intronic
917091795 1:171360136-171360158 TCCACTGCCCTCTTCAGAGCTGG - Intergenic
918271109 1:182900781-182900803 GCCTCTGCCTTCTTAAGAGCTGG - Intronic
920483991 1:206351302-206351324 TGCTCTGCCCCCTTAAGAAAGGG + Intronic
921898571 1:220426474-220426496 TGCTCTGCTCTGTGAAGTGGTGG - Intergenic
922354970 1:224766842-224766864 TGCACTGCCCTTGGAAGAGGTGG - Intergenic
922462374 1:225823631-225823653 TGCTCTGTCCTCTTGAGTGCTGG + Intronic
1062868205 10:875722-875744 GGCTCTGCCCTCACAAGTGGAGG - Intronic
1064732380 10:18346108-18346130 TCCACTCTCCTCTTAAGAGGTGG + Intronic
1067012874 10:42730888-42730910 TGGTCTGGCCTCCGAAGAGGTGG + Intergenic
1071536510 10:86436769-86436791 TGATGTGCCCTGTTAAAAGGAGG - Exonic
1072365317 10:94703354-94703376 TGCTCTGTCCTAGGAAGAGGTGG + Intronic
1074364149 10:112844785-112844807 TGCGCTGCACAGTTAAGAGGAGG - Intergenic
1075395315 10:122122725-122122747 TTCTTCGCCCTCTTAAGGGGAGG + Intronic
1077135592 11:996639-996661 TGTGCTGCCCTCTGAAAAGGAGG + Intronic
1079015623 11:16866287-16866309 TGCTCTGCCCTCTTTACTGAGGG - Intronic
1079266150 11:18934889-18934911 TGATCTGCCCTCTTTAAATGAGG - Exonic
1079423064 11:20312615-20312637 TGCTATGCCATCTGAAGGGGAGG - Intergenic
1083038118 11:59659271-59659293 TGCACTGCCCTCATAATAGCTGG + Exonic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1083826307 11:65205857-65205879 TGCTCTGCCCACTGAACAGGTGG - Intronic
1085284355 11:75350457-75350479 TGCTGTGCCCACTTAGGGGGTGG + Intronic
1087082545 11:94185896-94185918 TGCTCACCTCTCTCAAGAGGAGG + Intergenic
1087766974 11:102165602-102165624 TGCTCAAGCCTCTTCAGAGGTGG - Intronic
1088361228 11:108992131-108992153 CTTTCTGGCCTCTTAAGAGGAGG + Intergenic
1088385350 11:109248249-109248271 TGCTCTCCTCTCTTCAGATGTGG + Intergenic
1089632204 11:119790952-119790974 AGCTATGCCCCCTTAAGAGGAGG + Intergenic
1091526843 12:1310935-1310957 TGCTCTCCCCTCTTCAGACCTGG - Intronic
1091660223 12:2377668-2377690 TGCACTGCTCACTTAAAAGGTGG + Intronic
1096088495 12:48882695-48882717 AGGTCTGCCCTCTCAATAGGGGG - Intergenic
1097526676 12:60746038-60746060 TCCTCTGCTCTCTTCAGAGCCGG - Intergenic
1097824410 12:64159719-64159741 AGCTCTGCCATCTTAACGGGAGG - Exonic
1099878490 12:88437573-88437595 TCCGCTGCCCTCTTCAGAGCTGG - Intergenic
1101298929 12:103457763-103457785 TGCTCTGCCCTCCTGGCAGGGGG + Intronic
1102168355 12:110823723-110823745 TGGTCTGCCCTCTTAGGCTGTGG + Intergenic
1103339528 12:120214085-120214107 TCCCCGGCCCTCCTAAGAGGCGG + Intronic
1104734225 12:131127029-131127051 TGCTGTGGCTTCCTAAGAGGAGG - Intronic
1106633425 13:31501481-31501503 TGCTTTATCCTCTGAAGAGGAGG - Intergenic
1111598970 13:90447272-90447294 TGCTCTGCCCTCAGACAAGGTGG - Intergenic
1111929366 13:94497956-94497978 TGCTCTGCACTTTTCAGTGGAGG + Intergenic
1112151979 13:96773778-96773800 TCCTCTGCTCTCTTCAGAGCTGG - Intronic
1115444737 14:33477022-33477044 TGCTCTGTCTTCCTTAGAGGTGG + Intronic
1116511832 14:45756137-45756159 TGCTGTGCTCTCTTCAGAGCTGG + Intergenic
1117121123 14:52568895-52568917 TCCGCTGCTCTCTTAAGAGCCGG - Intronic
1117732077 14:58733195-58733217 TGCTGTGTCCTCTGGAGAGGAGG + Intergenic
1120172500 14:81259735-81259757 TGCTCTGGGCTCTTAGAAGGAGG - Intergenic
1120491215 14:85180702-85180724 TGCACTCCCCTCTTAAGTGTTGG + Intergenic
1120780328 14:88480545-88480567 GGCTCTGCCTACTTAAGGGGTGG + Intronic
1122205906 14:100147844-100147866 TGCTCTGCCATCTCCTGAGGCGG + Intronic
1124161358 15:27272658-27272680 TGTTCTGCTCCCTTCAGAGGTGG - Intronic
1124596001 15:31091949-31091971 TGCAAAGCCCTCTTACGAGGTGG + Intronic
1125875044 15:43136704-43136726 TGCTCAGCCTTCTAAAGTGGTGG + Intronic
1127216035 15:56823983-56824005 TGCTCTGCACTCCCAAGACGCGG + Intronic
1127859156 15:62978716-62978738 CCCTCTGTCCTCTGAAGAGGAGG - Intergenic
1134033276 16:11009690-11009712 TGCACTGCCCCCTTAAGTTGTGG - Intronic
1135258390 16:20960303-20960325 AGCTTTGCACTCATAAGAGGTGG + Intronic
1136081156 16:27853461-27853483 TGCTCTGCCCTCTGAGGACACGG + Intronic
1138539302 16:57678898-57678920 TCCTCTGCCCTCTTAACTAGAGG - Intronic
1138597660 16:58037671-58037693 TGCTGAGCCCTCTTGAGAGCAGG - Intronic
1141436471 16:84002506-84002528 TGCTCTGCCTTCTCAGGTGGGGG - Exonic
1141921763 16:87140283-87140305 AGCTCTGCCCTCATTAGCGGTGG - Intronic
1141932909 16:87217480-87217502 TGCTCTGCTCCCCTAAGGGGAGG + Intronic
1142119324 16:88378140-88378162 AGCTCTGCCCTCCTGACAGGTGG + Intergenic
1142583277 17:954892-954914 AGCTCAGAGCTCTTAAGAGGGGG - Intronic
1147166144 17:38594495-38594517 TGCCCTGCCTTCTTAGGAGAGGG - Intronic
1149397129 17:56256391-56256413 TTCTCTGTCCTCATAAAAGGAGG + Intronic
1158382496 18:56948776-56948798 TGCTCTGTGCTCTTCAGAGTGGG + Intronic
1159787383 18:72730285-72730307 TTCTGTGGCCTCTTAAAAGGGGG + Intergenic
1164872532 19:31657960-31657982 TGCTTTGAACTCTTCAGAGGTGG - Intergenic
1164944555 19:32282500-32282522 TGGTCTGTCTTCTCAAGAGGTGG - Intergenic
1166682238 19:44776294-44776316 TGCTCGGCCTCCTAAAGAGGTGG - Intergenic
931884347 2:66599560-66599582 TGCTCTGCCATCTTACCAGGTGG - Intergenic
940209737 2:151244266-151244288 AGCTCTGCCCTCTCAAAAGCTGG + Intergenic
942716101 2:178894050-178894072 TTCTCTGCCCTCATTAGGGGAGG + Intronic
942866761 2:180685767-180685789 TGCACTGTTCTCTTAAGAAGTGG - Intergenic
943352270 2:186809535-186809557 TGATGTGCCCTCTGGAGAGGGGG + Intergenic
943408705 2:187519685-187519707 TCCTCTGCTCTCTTCAGAGCTGG + Intronic
943539195 2:189190771-189190793 TGCTCATCCTTCTTAAGATGGGG + Intergenic
946023326 2:216656771-216656793 GGCTCTGCCCTCTTGGGAAGTGG - Intronic
947464238 2:230326837-230326859 TGCTCTGCCCTCTTAAGAGGGGG - Intergenic
948575551 2:238947269-238947291 GGCTCTGCCCTCCTGAGAGGGGG - Intergenic
948575595 2:238947433-238947455 GGCTCTGCCCTCCTGAGAGGGGG - Intergenic
1170051898 20:12155381-12155403 TGTTCTGCCATCTTAGGATGTGG + Intergenic
1170387900 20:15840411-15840433 TCCCCTGCCCTCTTAAGGAGTGG + Intronic
1173311899 20:41904297-41904319 TGCTCTGCTCTCTTCCCAGGAGG + Intergenic
1175542509 20:59756508-59756530 TGCTCAGCCCTCTTCGGGGGTGG + Intronic
1182102761 22:27669650-27669672 GGCTCTGCCCTTTTGAGAGGAGG - Intergenic
1182261512 22:29075297-29075319 TGCTCTGCCCTTTCCAGAAGGGG - Intronic
1182578366 22:31289278-31289300 TTCTGGGCCCTCTTAGGAGGAGG - Intronic
1183647365 22:39134401-39134423 TGCGCAGCCCCCTGAAGAGGAGG - Exonic
1184331010 22:43827956-43827978 TGCTCTGCCTTTATAAGAGACGG + Intronic
949488060 3:4559904-4559926 TAGTCTCCCCTCCTAAGAGGCGG + Intronic
952506038 3:34007571-34007593 TGCTCTGCTCTCCTAAGACATGG - Intergenic
953420986 3:42753048-42753070 TGCTGTGCCCTCTAATGAGCAGG + Intronic
955682073 3:61513033-61513055 TGCTCTGCCCTGGGATGAGGAGG + Intergenic
964820726 3:160766153-160766175 TGCTCTGTACTTTTCAGAGGAGG - Intronic
968880600 4:3296881-3296903 TGCTGTGCCTTTTTAGGAGGTGG + Intronic
972203970 4:36748331-36748353 TGCTCAGCGCTCATAAGAGGAGG - Intergenic
972305589 4:37826858-37826880 TGCTCTGCCCTCTCCAGGCGCGG + Intronic
975424923 4:74214748-74214770 TCCACTGCTCTCTTAAGAGCTGG + Intronic
976277610 4:83293421-83293443 TGCTCTGCCATCTTTAGCGCTGG - Exonic
981745771 4:148050920-148050942 TACTCTGGGCTCTTAATAGGAGG + Intronic
984954461 4:185031732-185031754 TGCTCTGCACTCTTAATACCGGG - Intergenic
988215306 5:28264340-28264362 TGCTCTGCCCTCTTTAGCGTGGG + Intergenic
990003318 5:50920376-50920398 TGTTTTGCCTTCTTAAAAGGTGG + Intergenic
990673823 5:58161861-58161883 TCCTCTGCTCTCTTCAGAGCTGG + Intergenic
990869391 5:60415266-60415288 TGCTGTCACCTCTTAATAGGTGG - Intronic
993107132 5:83612181-83612203 ATCTCTGCCCTCTAGAGAGGTGG - Intergenic
994819096 5:104625334-104625356 AGCTCTGCCTTCTTAGGAGGTGG - Intergenic
996516168 5:124372130-124372152 TGCTCTCCCATCTGAAGAAGTGG + Intergenic
998522474 5:142813426-142813448 TGCTCTGCCCTTCAAAGAGTGGG + Intronic
998897491 5:146815226-146815248 TGCTTTGGCTTGTTAAGAGGAGG - Intronic
1000994518 5:167945405-167945427 TGCTCTCCCCTTTAAAGATGAGG - Intronic
1002663165 5:180804392-180804414 GGCTCTGGCCACTTAAGCGGAGG - Intronic
1002898968 6:1394890-1394912 TCCTCTCCCCTCCTCAGAGGGGG + Exonic
1003268065 6:4583927-4583949 TTATCTGCCCTCTTAAAAGCAGG - Intergenic
1005710280 6:28497867-28497889 TCCTCTGCCCTCCTCAGAAGTGG + Intergenic
1007044890 6:38762878-38762900 TGCTCTGACCTCTGAACTGGAGG + Intronic
1010273070 6:73937003-73937025 TGCTCTGCCATCCTTAGTGGTGG + Intergenic
1011580572 6:88859512-88859534 TGCTCTAACCTCTAAGGAGGTGG + Intronic
1011667802 6:89651868-89651890 TGCTGTGCCATCCTAAGAAGAGG - Intronic
1015721840 6:136250438-136250460 TGCTTTTCCTTCTCAAGAGGCGG + Intergenic
1016230266 6:141795423-141795445 TGCTCTGCCCATGTAAGATGTGG - Intergenic
1016373348 6:143396294-143396316 TGGTTTTCCCACTTAAGAGGAGG - Intergenic
1018794659 6:167176479-167176501 CGCTCTCCCCTCTGAGGAGGAGG - Intronic
1018821661 6:167378588-167378610 CGCTCTCCCCTCTGAGGAGGAGG + Intronic
1019444434 7:1063967-1063989 TGTTCTTCCCTCTGCAGAGGTGG + Intronic
1021622501 7:22562471-22562493 TGTTCTGCCCTCTGAAGAAGGGG + Intronic
1023051697 7:36258365-36258387 TCCACTGCTCTCTTAAGAGCTGG + Intronic
1027582941 7:80020724-80020746 TCCTCTGCTCTCTTCAGAGCTGG - Intergenic
1028088538 7:86668582-86668604 TTCTCTGCCCTCTAAAGACGGGG - Intronic
1029061708 7:97805304-97805326 TGATCTGCCCGCTTAAGTGCTGG - Intergenic
1030697240 7:112599265-112599287 TTCTCTGCCATGTTATGAGGTGG - Intergenic
1031987542 7:128172848-128172870 TTCTCTGCCCTTTTCAGAAGAGG + Intergenic
1033030445 7:137820914-137820936 TGCTCTGACATTTTCAGAGGAGG - Intronic
1033647895 7:143319100-143319122 TGCTCTGTCCTCTTCACATGTGG + Intronic
1036746232 8:11412112-11412134 TGCTCTGCCCCTTGAAGTGGAGG + Intronic
1040655319 8:49500801-49500823 TGCTCTGCCGTGGTAAGATGTGG + Intergenic
1046623158 8:116549422-116549444 TGCTGTGTCCTCTGAAGGGGAGG - Intergenic
1046814067 8:118564879-118564901 GGCTCTGCCATCTTAACATGTGG + Intronic
1049386899 8:142347413-142347435 GGCCCTGCCCTCTTGGGAGGGGG - Intronic
1050122748 9:2324829-2324851 TGCTCATCCCTCTGAAGAGAAGG + Intergenic
1054742638 9:68823700-68823722 TATTTTGCCCTCTTAAGAGTAGG + Intronic
1058299871 9:103358710-103358732 TGCTCTGCCATGGTAAGACGTGG - Intergenic
1058578096 9:106425200-106425222 TGTTCTGCTCTCTTGAGAGTGGG - Intergenic
1061131791 9:128712695-128712717 TGCTCTGCCCTGGAAAGAGGTGG + Intronic
1062232342 9:135488653-135488675 TGCTCTGGCCTCTAAGGACGTGG - Exonic
1188210476 X:27418448-27418470 TGCTCTGCCCTCTCTTGTGGGGG - Intergenic
1191788708 X:64945620-64945642 TCCTCTGCTCTCTTCAGAGCTGG + Intronic
1192128930 X:68530005-68530027 TGCGCTGCTCTCTTCAGAGCTGG + Intronic
1192170545 X:68851858-68851880 CACTCTGCCCTCTTTTGAGGTGG + Intergenic
1196367762 X:114942752-114942774 TCCACTGCTCTCTTCAGAGGTGG + Intergenic
1197191147 X:123648916-123648938 TCCGCTGCCCTCTTCAGAGCTGG - Intronic
1198058199 X:133016342-133016364 AACTCTGCCCTCTAAATAGGAGG - Intergenic
1198486763 X:137095155-137095177 GGCTCAGCCATGTTAAGAGGAGG + Intergenic