ID: 947464908

View in Genome Browser
Species Human (GRCh38)
Location 2:230334568-230334590
Sequence ATGTAAATCCAACACTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947464908_947464910 -9 Left 947464908 2:230334568-230334590 CCATTCCAGTGTTGGATTTACAT 0: 1
1: 0
2: 1
3: 7
4: 172
Right 947464910 2:230334582-230334604 GATTTACATGTATTTTATTGTGG 0: 1
1: 0
2: 21
3: 460
4: 8950
947464908_947464911 -8 Left 947464908 2:230334568-230334590 CCATTCCAGTGTTGGATTTACAT 0: 1
1: 0
2: 1
3: 7
4: 172
Right 947464911 2:230334583-230334605 ATTTACATGTATTTTATTGTGGG 0: 1
1: 1
2: 3
3: 76
4: 731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947464908 Original CRISPR ATGTAAATCCAACACTGGAA TGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
909539613 1:76776487-76776509 ATTTAAATCCCAAAATGGAAAGG + Intergenic
910126072 1:83843969-83843991 ATGTCACGCAAACACTGGAATGG + Intergenic
912214613 1:107594032-107594054 AAGTAAATAAAACACTGGAATGG + Intronic
913396904 1:118381581-118381603 CTTTAATTCCAACACAGGAAAGG + Intergenic
916254459 1:162772321-162772343 TTGTGAATCCACCTCTGGAAGGG - Intronic
916444396 1:164858697-164858719 TTGCAAAGCAAACACTGGAAGGG + Intronic
917703385 1:177603802-177603824 ATGTAAAGCCAGCAATGTAAGGG + Intergenic
923884567 1:238140316-238140338 ATCTGAATCCCACACTAGAAGGG - Intergenic
924078684 1:240369352-240369374 ATGAAACTAAAACACTGGAAAGG - Intronic
1063345619 10:5309875-5309897 ATGTAAATCCAAGGGTGGAGTGG - Intergenic
1063465883 10:6244111-6244133 CTGTAATCCCAACACTGGAGAGG - Intergenic
1064666841 10:17661905-17661927 ATGTAAATACAACAAAGGGATGG - Intronic
1068209788 10:53906354-53906376 ATGTAAACCAAGCTCTGGAAAGG - Intronic
1068607386 10:59020967-59020989 ATGCAAGTTTAACACTGGAATGG - Intergenic
1068954864 10:62813511-62813533 ATGCAGATCCGACACTGGAAGGG + Exonic
1069387915 10:67901343-67901365 ATGAAAATCCAGCACTGGACTGG - Intronic
1071122645 10:82297450-82297472 ATGTAAATCAACCATTGGAGAGG + Intronic
1072175475 10:92916544-92916566 AGGTCAATCCAAAACTGTAAGGG + Intronic
1072627221 10:97120346-97120368 ATGTAAAGCAGACATTGGAAAGG - Intronic
1072793551 10:98336897-98336919 CTGTAAATCCAAGAGTCGAAAGG + Intergenic
1080172389 11:29320925-29320947 TTGTAAATACAAAAGTGGAAAGG + Intergenic
1085281612 11:75334679-75334701 ATGTAAATTAGAGACTGGAAAGG - Intronic
1085842378 11:80027270-80027292 ATATATATCCAGCAGTGGAATGG - Intergenic
1085924344 11:80997789-80997811 ATTTAACTCCAACACTGGTGTGG + Intergenic
1086453715 11:86941651-86941673 CTGTATATAGAACACTGGAATGG - Intronic
1087319989 11:96646564-96646586 ATGTAAATTCCACAAAGGAAGGG - Intergenic
1095882977 12:47158369-47158391 ATGCAAATCGAAAACTGGAAAGG - Intronic
1099124967 12:78742804-78742826 AAGTAAAGCCCACAGTGGAATGG - Intergenic
1099288247 12:80742684-80742706 TTCTAAATCAAACACAGGAAAGG + Intergenic
1100311845 12:93402977-93402999 ATGTGAAGACAACATTGGAAAGG - Exonic
1100608130 12:96168691-96168713 CTGTAATTCCAACACTTGAAAGG - Intergenic
1101030059 12:100649523-100649545 ATGTAAATAAAACAATGGATTGG + Intergenic
1101110650 12:101482471-101482493 ATGGGCATCCAACACAGGAATGG + Intronic
1104406252 12:128519636-128519658 TTCTAAATCCATCACTGGTAAGG + Intronic
1106026415 13:25959988-25960010 GTCAAAATCCAACCCTGGAATGG - Intronic
1106312404 13:28565271-28565293 ATGGCAGTCCAAAACTGGAAGGG - Intergenic
1110043016 13:70789277-70789299 ATGAAAATCCAACAGTACAAAGG + Intergenic
1110636036 13:77767895-77767917 ATATAAATCAAACATTTGAATGG - Intergenic
1111449479 13:88395174-88395196 ATATAAATTTAACACAGGAAGGG + Intergenic
1113544676 13:111139110-111139132 ATGGAAATAAAACACTGGATGGG + Intronic
1115006081 14:28486601-28486623 ATCTAAATCCAGCACTAGAAAGG + Intergenic
1119238537 14:73039888-73039910 ATGTGCAGCCAACAGTGGAAAGG + Intergenic
1119689015 14:76656018-76656040 ATGTAAATTCCACACAGGCAGGG + Intergenic
1119772960 14:77232683-77232705 ATGTATATCAAACACTGTATAGG - Intronic
1124827309 15:33111021-33111043 ATGTAAAACTAACATTTGAATGG - Intronic
1125798360 15:42421614-42421636 ATCTGAATGGAACACTGGAATGG - Intronic
1126433601 15:48612848-48612870 ATGTATTTCCCAAACTGGAAAGG + Intronic
1131208164 15:90469460-90469482 ATGAAGATGAAACACTGGAAGGG - Intronic
1134036305 16:11033781-11033803 ATGAATATCCCACAGTGGAAAGG + Intronic
1134179042 16:12032849-12032871 ATAAAAACCCAACACTGGCAAGG - Intronic
1134188080 16:12099858-12099880 ATGCAAATCCATCTCTGGAGTGG + Intronic
1136747360 16:32602872-32602894 AAGTAAACCCAAACCTGGAATGG - Intergenic
1137633133 16:49962151-49962173 ATGAAAATCCAACGCTGCTAAGG + Intergenic
1141180418 16:81749125-81749147 ATGTAAATCAAACCCTGGTTTGG - Intronic
1203049495 16_KI270728v1_random:862078-862100 AAGTAAACCCAAACCTGGAATGG - Intergenic
1146695198 17:34903587-34903609 ATGTCATTCTAACACTGCAATGG + Intergenic
1146704798 17:34993225-34993247 CAGGAAAACCAACACTGGAAAGG - Intronic
1146788227 17:35736093-35736115 ATTTAAATCCAAACCTGGCAGGG - Intronic
1147518561 17:41145626-41145648 ATGTAAATTTATAACTGGAAAGG - Intergenic
1150936391 17:69640354-69640376 ATGTAAATAAAATACTGTAATGG - Intergenic
1152439586 17:80297833-80297855 CTGTAATTCCAGCACTGGAGAGG + Intronic
1154291369 18:13110797-13110819 ATGTAAATCCCAGAGTGCAAAGG + Intronic
1155046708 18:22109409-22109431 CTGTAATCCCAGCACTGGAAAGG - Intergenic
1156193248 18:34744357-34744379 GTGTGAATCCAACAGTGGCATGG - Intronic
1157208966 18:45724707-45724729 CCATAAATCCATCACTGGAAAGG - Intronic
1158616414 18:58991857-58991879 AGGTACCCCCAACACTGGAAAGG - Intergenic
1159536761 18:69724940-69724962 TTGTAAAACCAACATTGTAATGG + Intronic
1161408135 19:4101821-4101843 GTCTTAATCCAACACTGGTATGG + Intronic
1163025756 19:14510842-14510864 ATCACAATACAACACTGGAAAGG - Intergenic
925079147 2:1047790-1047812 ATATACAGCCAACACTTGAATGG - Intronic
929419403 2:41775637-41775659 AACTAAACCCAACACTGTAATGG + Intergenic
930934578 2:56932203-56932225 ATGAAAAGACAAAACTGGAAAGG - Intergenic
931063731 2:58560818-58560840 ATGAAAATCCAAAACAGGACTGG - Intergenic
931232158 2:60383991-60384013 ATGTAAATTCATCACTGTGATGG + Intergenic
931816905 2:65913301-65913323 ATGTAAAGCCAGCACTTGATAGG + Intergenic
934194413 2:89827669-89827691 ATGGAAAGGCAAGACTGGAATGG - Intergenic
934591558 2:95555664-95555686 ATGCACATCCCACACTGGGAAGG + Intergenic
937622955 2:124010392-124010414 ATGTAAATACAACTTTGGCATGG + Intergenic
944274047 2:197815611-197815633 ATGTAAATTGAAACCTGGAAAGG + Intronic
946464509 2:219899658-219899680 AAGTAAATTGAAAACTGGAAAGG - Intergenic
947464908 2:230334568-230334590 ATGTAAATCCAACACTGGAATGG - Intronic
947775825 2:232708576-232708598 CTGTAATTCCAGCACTTGAAAGG + Intronic
1173243223 20:41316813-41316835 ATGAAAATCCCAAACTGGGAAGG + Intronic
1173342427 20:42164375-42164397 CAGCAAAACCAACACTGGAATGG + Intronic
1175197629 20:57255418-57255440 ATCTAAATGCATCACTGAAATGG - Intronic
1176695655 21:9974032-9974054 ATGTATTTCCAAAAGTGGAAAGG - Intergenic
950884478 3:16351145-16351167 ATGTAAATACAATAGAGGAATGG + Intronic
951039444 3:17972589-17972611 AAGTAAATCCAGCACTGACATGG - Intronic
954927486 3:54249114-54249136 AACCAAATCCAACACTAGAAAGG - Intronic
956141593 3:66151770-66151792 ATGTAACTACTACACTGGAGAGG - Intronic
958805512 3:98805268-98805290 ATGTTAATGAAACACTTGAATGG + Intronic
958895530 3:99825061-99825083 ATGTAAAACTAATACTGTAAAGG - Intronic
959398535 3:105870404-105870426 ATGTAAATTCAAGGCTGTAAAGG - Intergenic
959557526 3:107739348-107739370 ATTTAAATTCTACACTGAAAAGG + Intronic
962878939 3:139557925-139557947 ATGTAAATCCCACAAATGAATGG - Intergenic
962948183 3:140192762-140192784 ATCTAAATACAACAATGAAAAGG - Intronic
963010718 3:140767739-140767761 ATGCAAATGCAACATAGGAAAGG + Intergenic
963486265 3:145937811-145937833 ATGCAAATCAAAATCTGGAAGGG - Intergenic
963968149 3:151397099-151397121 AAAAAAATCCAACACTGTAATGG - Intronic
966313335 3:178618334-178618356 ATGTAAATGAAACATTGGCAAGG - Intronic
968840347 4:2999867-2999889 TTGTAAATCAAATACTGGTAAGG + Intronic
969934846 4:10669949-10669971 ATGCACATCAAATACTGGAAGGG + Intronic
970138171 4:12949449-12949471 ATGTAAACCCACCACTGAACAGG - Intergenic
972297725 4:37756181-37756203 CTGTAATTCCAGCACTTGAAAGG - Intergenic
974420642 4:61668759-61668781 TTGTAATTCCAACACTCGAGAGG + Intronic
975435942 4:74351221-74351243 ATGTAAATGGAACACCAGAAAGG + Intergenic
978591649 4:110330326-110330348 ATGTAAATCCAAAACCAGCAGGG - Intergenic
980293311 4:130873056-130873078 ATGGTTTTCCAACACTGGAATGG - Intergenic
982749419 4:159141691-159141713 ATGAAAATCCATCGCTGGCATGG - Intronic
983931377 4:173456657-173456679 CTGTATATCCAGCACTGGTAAGG + Intergenic
984482091 4:180318476-180318498 ATGAAAATTCAAGACAGGAAAGG + Intergenic
984482401 4:180322710-180322732 ATGAAAGTCCATCACAGGAAGGG + Intergenic
987362237 5:17117898-17117920 ATGTCATTCCAACAATGGACAGG - Intronic
987920041 5:24267985-24268007 AAGTAAATTGAAAACTGGAAAGG + Intergenic
989231697 5:39094516-39094538 ATCTGAATCCAACACTTCAATGG + Intergenic
989376378 5:40766739-40766761 CTGTAATCCCAACACTGGGAGGG + Intronic
990257554 5:53986955-53986977 ATTTAAATCTAAGACTAGAAGGG + Intronic
991108916 5:62875453-62875475 ATGTACATGCAACAATGGATAGG + Intergenic
992734734 5:79707589-79707611 AGGTTAATTCAACACTGAAAAGG + Intronic
993721858 5:91329262-91329284 ATGAAATTCCAACACTGAAGAGG - Intergenic
994884640 5:105544013-105544035 CAGAAAATCCAACACTGGCAGGG - Intergenic
996145873 5:119975496-119975518 ATGTTAATCCAACATGGAAAAGG + Intergenic
997242638 5:132319041-132319063 ATGTAAATCCACTTCTGAAAGGG + Intronic
998297845 5:140988597-140988619 ATGTAAATAAAAGACTAGAATGG + Intronic
998669382 5:144336352-144336374 CTGCTAATCCAAGACTGGAACGG + Intronic
998884172 5:146676649-146676671 ATGTAAAGCCGACAGTGTAATGG - Intronic
1001251813 5:170152605-170152627 ATGTACATCCCTCACTGCAAGGG - Intergenic
1001987523 5:176087431-176087453 AAGTAAACCCAAATCTGGAATGG - Intronic
1002229347 5:177750711-177750733 AAGTAAACCCAAATCTGGAATGG + Intronic
1002265998 5:178033062-178033084 AAGTAAACCCAAATCTGGAATGG - Intronic
1003104799 6:3207173-3207195 CTGTAATCCCAACACTGGGAGGG + Intergenic
1004066102 6:12245976-12245998 ATGTAAATACAACATTGTTATGG - Intergenic
1007035794 6:38672236-38672258 ATGTAAAGCCCACACTGGCTGGG - Intergenic
1010323918 6:74543544-74543566 ATGTACATCAAACCTTGGAAAGG - Intergenic
1011430164 6:87277334-87277356 ATGGCAAACTAACACTGGAAAGG + Intergenic
1013165863 6:107591480-107591502 ATCTAAATCCAACCCATGAAAGG - Intronic
1015336569 6:132045928-132045950 ATGGAAATCCATCATAGGAAGGG - Intergenic
1016396820 6:143632534-143632556 ATGGACATCCACCACTAGAATGG + Intronic
1016952899 6:149598465-149598487 CTGTAATCCCAACACTGGGAGGG + Intronic
1018716868 6:166539769-166539791 CTGGAAATGGAACACTGGAAAGG + Intronic
1020079363 7:5278775-5278797 ATCTAAATAGAACAATGGAAAGG - Intronic
1021244807 7:18248066-18248088 AAGTAAATTAAACACTGTAAAGG - Intronic
1022121553 7:27313343-27313365 ATGTCAGTCCGACACTGGATAGG + Intergenic
1022344273 7:29499149-29499171 ATGAAAATCCAAAGCTGAAAAGG - Intronic
1026369523 7:69684589-69684611 ATGTAAATTCATCACTGGTCTGG - Intronic
1029271475 7:99379682-99379704 ATGTAAACCCAGCACAGTAAGGG + Intronic
1030095734 7:105897669-105897691 AGGCCAATCCAACATTGGAATGG + Intronic
1030114056 7:106049943-106049965 GTGTAACTCCAACAATGAAATGG - Intergenic
1030572175 7:111241013-111241035 ATGTAAATGCTACACTGTCATGG + Intronic
1032216224 7:129959417-129959439 AGGTAAATCCTAGGCTGGAAGGG - Intergenic
1032539435 7:132691058-132691080 ACGTAAATCCAAGACAGCAATGG - Intronic
1036928350 8:12929234-12929256 ATGTAACTCAGACACTGGAATGG - Intergenic
1037041491 8:14241160-14241182 ATATAAATCAGACAGTGGAATGG - Intronic
1037276332 8:17183784-17183806 AGGGCAATCCAACAGTGGAACGG + Intronic
1037418903 8:18681062-18681084 ATGTAATTCCAACTCTGACAAGG + Intronic
1037901215 8:22690705-22690727 ATGCAGATCCGGCACTGGAAGGG + Exonic
1038766143 8:30429502-30429524 ATGTATATCAATCACTGGATGGG - Intronic
1041505704 8:58595194-58595216 GTGTAAATCCAACACTCGTGGGG + Intronic
1043613943 8:82102303-82102325 ATGGAGCTCCAAAACTGGAAAGG + Intergenic
1045393377 8:101736786-101736808 ATGGCCATCCAACTCTGGAAAGG + Intronic
1045640001 8:104239065-104239087 ATGTGAATCCAAGATTTGAAAGG + Intronic
1045833862 8:106496918-106496940 ATGTAAACCAAAGACTGGGAGGG + Intronic
1046450933 8:114388333-114388355 AGGTATGTCCAGCACTGGAATGG + Intergenic
1050177254 9:2881110-2881132 ATGTTCTTCCAACAATGGAAGGG - Intergenic
1052245832 9:26333390-26333412 AGCTAAATTCAACACTGCAAGGG + Intergenic
1053632639 9:39959989-39960011 ATGTATTTCCAAAAGTGGAAAGG - Intergenic
1053773121 9:41503544-41503566 ATGTATTTCCAAAAGTGGAAAGG + Intergenic
1054211249 9:62290708-62290730 ATGTATTTCCAAAAGTGGAAAGG + Intergenic
1054313731 9:63558138-63558160 ATGTATTTCCAAAAGTGGAAAGG - Intergenic
1055848881 9:80600928-80600950 TTGAAAATCCAACACTAGGAAGG - Intergenic
1061806495 9:133140243-133140265 ATGTAAGTTCAAAACTGGGAGGG - Intronic
1062001095 9:134216124-134216146 ATGTAAATAAAACACTGGAAAGG + Intergenic
1189146210 X:38657624-38657646 AAGTAACTCTAGCACTGGAAGGG + Intronic
1193236196 X:79110835-79110857 ATGTAAATCCTCAAGTGGAATGG + Intergenic
1193355401 X:80514236-80514258 CTGTAAATTAAACACTAGAATGG - Intergenic
1193694075 X:84685322-84685344 AAAAAAATACAACACTGGAATGG - Intergenic
1195045656 X:101052152-101052174 ATGTAGATCCACCAATGGGACGG - Intergenic
1196333161 X:114495992-114496014 ATGCAAGTCCAACTCAGGAATGG + Intergenic
1198633992 X:138674950-138674972 ATGATAATCAAACACAGGAAAGG + Intronic
1199802287 X:151263441-151263463 ATATAATTGCAAGACTGGAAAGG - Intergenic