ID: 947466110

View in Genome Browser
Species Human (GRCh38)
Location 2:230347881-230347903
Sequence TCTGCTAGGGTGCTGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947466104_947466110 19 Left 947466104 2:230347839-230347861 CCAGCTTGCCTCTGCAGTTGGGC 0: 1
1: 1
2: 4
3: 11
4: 190
Right 947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 129
947466105_947466110 11 Left 947466105 2:230347847-230347869 CCTCTGCAGTTGGGCAGAGCTGC 0: 1
1: 0
2: 5
3: 55
4: 320
Right 947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG 0: 1
1: 0
2: 2
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947466110 Original CRISPR TCTGCTAGGGTGCTGATGGC AGG Intronic
900506393 1:3031691-3031713 CCTGCGAGGGTGGTGATGGGCGG - Intergenic
902995742 1:20223424-20223446 TGAACTAGGGTGCTGATGGTGGG - Intergenic
903574129 1:24327550-24327572 TCTGGTAGAGATCTGATGGCAGG + Intronic
907352636 1:53845459-53845481 TCTACTATGCTACTGATGGCAGG - Intergenic
915849487 1:159306008-159306030 TCTGCTGAGGTGGTGATGGAGGG + Exonic
916477829 1:165186565-165186587 TCTGCTCAGGAGATGATGGCAGG - Intergenic
917582242 1:176391075-176391097 CCAGCAAGGGTGCTGATGGACGG - Intergenic
920331094 1:205208981-205209003 CCTGGGAGGGTGCAGATGGCAGG - Intronic
922749256 1:228063054-228063076 TCTGCAAGGCTGCTGCAGGCAGG - Intergenic
1065242853 10:23725173-23725195 TATACCAGGGTGCTGAAGGCAGG - Intronic
1065828703 10:29595375-29595397 TCTGCTAGGGTATGGATGGCAGG + Intronic
1066083117 10:31952023-31952045 TCAGCTGAGGTGCTGAAGGCAGG + Intergenic
1066526348 10:36283804-36283826 TCGCCGTGGGTGCTGATGGCGGG + Intergenic
1068518392 10:58051784-58051806 TCTGAAAGGGTGCCGAGGGCAGG - Intergenic
1072573779 10:96681121-96681143 CCTGCTTGGTTGCAGATGGCTGG + Intronic
1075073041 10:119331425-119331447 TCTGCTGGGGTCCTGCTGGAAGG + Intronic
1078470005 11:11579072-11579094 TCTGCTGGGGTGCTGCTGGCTGG - Intronic
1081227712 11:40545097-40545119 TTTGCTTGGGTGATGATGGGAGG - Intronic
1081670357 11:44938999-44939021 GCTGGTGGGGGGCTGATGGCCGG - Intronic
1083852525 11:65376651-65376673 TCAGCCACGGTGCTGGTGGCAGG - Exonic
1088074561 11:105831089-105831111 TCTGCTCCTGTGATGATGGCTGG + Intronic
1090665613 11:128913213-128913235 TCTGCAAGAATGCTGAGGGCTGG - Intronic
1090878498 11:130812814-130812836 CCTGCCAGGGTCCTCATGGCTGG + Intergenic
1092192496 12:6531114-6531136 ACAGCTAGGGTGCAGAGGGCTGG + Intronic
1093735264 12:22613826-22613848 ACCGCTATGGTGCTGATGGGAGG - Intergenic
1095689262 12:45069020-45069042 TCTGCTAGGGTGGTGCAGACGGG - Intergenic
1096253373 12:50047892-50047914 TCAGCTAGGGTGCTGAAGCAAGG - Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1101833554 12:108278407-108278429 TCTGCTAGGGGGTTGGGGGCGGG + Intergenic
1102155630 12:110725412-110725434 CCTGCTAGAGTACTGAGGGCTGG - Intronic
1105574295 13:21636020-21636042 TCTGCTAGGGTGCTTATGATGGG - Intergenic
1105777317 13:23675678-23675700 GCTGCTAGAGTGCCGATGTCAGG + Intronic
1106324332 13:28673565-28673587 TTTGCTTGGCTGCTGATGTCCGG + Intronic
1121944436 14:98105355-98105377 TCTCCTAGGGGTCTGGTGGCAGG + Intergenic
1124971962 15:34496547-34496569 TCTGCCAGGGTGGTGGTGGCGGG + Intergenic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1128571818 15:68739127-68739149 TCTGCAAGGGTCCTGAGTGCGGG - Intergenic
1128764489 15:70242893-70242915 CCAGCTGGGCTGCTGATGGCAGG + Intergenic
1129070510 15:72946541-72946563 CATGCTTGGGTGCTGGTGGCAGG - Intergenic
1129093248 15:73174363-73174385 CCTGCTGGGGTGCTGTGGGCTGG + Intronic
1129481608 15:75830943-75830965 GCTGCTAGGGTGATGCTGACGGG - Intergenic
1130958570 15:88644711-88644733 TCTGTTCAGGTGCTGATGGGAGG + Intronic
1131524700 15:93143544-93143566 CCTGCTGGGGTGTTGATGGGTGG + Intergenic
1133719518 16:8481898-8481920 TGTGCTGGTGTGCTGATGCCAGG + Intergenic
1135055293 16:19226982-19227004 TGTGCTGGGGAGCTGATGTCTGG + Intronic
1137744453 16:50810467-50810489 TCAGCTAGGGAGCAGTTGGCAGG + Intergenic
1138107543 16:54297069-54297091 TCTCCTTGTGTGCTGATGGCTGG + Intergenic
1141543083 16:84741853-84741875 CCTGCTCAGCTGCTGATGGCAGG + Intronic
1142273927 16:89105792-89105814 TCTCCCAGGGAGCTGAGGGCAGG + Intronic
1142560427 17:806161-806183 TGTGCTGGGGTGCAGACGGCGGG - Intronic
1142560444 17:806207-806229 TGTGCTGGGGTGCAGACGGCGGG - Intronic
1143314011 17:6017661-6017683 TCTGCTAGGGTGAGGTTGGGAGG - Intronic
1144853800 17:18257423-18257445 GTTGCCAGTGTGCTGATGGCAGG - Intronic
1147426188 17:40346959-40346981 GCTGCTAGGCGGCTGATGACAGG - Intronic
1151692394 17:75694603-75694625 TCTGCTGGGAAGCCGATGGCCGG + Intronic
1151800599 17:76377149-76377171 TCTGCCAGGCTGCAGATGGATGG + Intronic
1155509405 18:26561949-26561971 TCTCCTAGAGTGCTGATGTTGGG + Intronic
1156027371 18:32670116-32670138 TATGCTTGGGTGCTGGTGGCAGG + Intergenic
1156081438 18:33340865-33340887 TCTGCTAGGGTGCTGAGGAAGGG + Intronic
1158146667 18:54322379-54322401 TTTGCCAGAGTGGTGATGGCAGG - Intergenic
1158439502 18:57462034-57462056 TCTCCTAGGCTGCTGGTGGGAGG - Intronic
1161354460 19:3811128-3811150 TCGGCCAGGAAGCTGATGGCAGG + Intronic
1166422969 19:42652826-42652848 CCTCCTAGGGTGCAGAGGGCAGG - Intronic
925479118 2:4250829-4250851 TCTGCTCTGGTGGAGATGGCAGG - Intergenic
928125692 2:28614291-28614313 TCTGCTTGGGGGCTGACGTCAGG - Intronic
930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG + Intronic
941554971 2:166966753-166966775 TCTCCTAGTGTTCTGATGGCAGG + Intronic
943948907 2:194103918-194103940 TCTCTGAGGGTGCAGATGGCTGG + Intergenic
944903329 2:204238116-204238138 TCTGCTTAGGTCCAGATGGCTGG - Intergenic
946318449 2:218932900-218932922 TCTTCTGGGGGGCTGTTGGCAGG - Intergenic
947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG + Intronic
947474555 2:230431123-230431145 TCTGATAGGGTGCTGATGTCAGG + Intronic
1169320872 20:4632264-4632286 TCTGCTAGGGTAGTGAGGGAGGG + Intergenic
1169358451 20:4927436-4927458 TGTGAGAGGGTGCTGCTGGCAGG - Intronic
1170272293 20:14540757-14540779 TCTCTAAGGGTGCTGATAGCAGG - Intronic
1170781656 20:19430986-19431008 TGTGCTGGGGTCCTGAGGGCAGG - Intronic
1172449792 20:35013875-35013897 TCTGCCATGGTGCTGCTGGTGGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175305961 20:57975675-57975697 TCAGCTAGGGTGTTGGGGGCTGG + Intergenic
1176158850 20:63638340-63638362 TCTGCAAGGGAGAAGATGGCAGG - Intergenic
1176511201 21:7749644-7749666 TCTTCCAGGCTGCTGACGGCTGG - Intronic
1178645315 21:34380173-34380195 TCTTCCAGGCTGCTGACGGCTGG - Intronic
1180869242 22:19137170-19137192 AATGCCAGGGTGCTGAAGGCAGG - Intronic
1182347500 22:29676993-29677015 TCTGCAAGGGTGCTGAGAGAAGG - Intronic
1184993842 22:48188268-48188290 TCTGCTGGGATGCTGAGGGATGG - Intergenic
950436733 3:12984664-12984686 TCTCCTAGGGGGCTGAGGGGTGG - Intronic
953280347 3:41548446-41548468 TGTGCTTGGGTGCTGGTGGCAGG - Intronic
953449793 3:42996663-42996685 TATGCTAGGCTGGTGATGGCAGG + Intronic
954445743 3:50545949-50545971 TCTACCAGGGTGCTGAAAGCAGG + Intergenic
954638343 3:52083751-52083773 CCTGCTATGGGGCTGATGCCAGG + Intronic
955221363 3:57026005-57026027 TCTGCTAGGGTGTGAATGGGGGG - Intronic
956668111 3:71660972-71660994 TCTGCTGGGCTGCTGGTGGAAGG - Intergenic
957215802 3:77317835-77317857 GCTGCTAGGGGGCTGCTGGGGGG + Intronic
961455156 3:127020409-127020431 GCTCCTTGGGTGCTGATGGATGG + Intronic
961746607 3:129067948-129067970 TTTGATAGGGTGCTGATTGGTGG + Intergenic
965868425 3:173235531-173235553 TCTGCTGGGTTGATGAGGGCTGG - Intergenic
969056866 4:4407720-4407742 TCTGCAAGGCTGCAGATGCCTGG - Intronic
969655930 4:8498634-8498656 CCTGCCAGGGTGCTGAAGGAGGG + Intergenic
974026585 4:56738322-56738344 AGTGCTAGGGAGATGATGGCAGG + Intergenic
976070121 4:81231516-81231538 TCTGCTAGGGTGCTGTGGAAGGG + Intergenic
977417263 4:96749247-96749269 TCTGCTAGGGTGGTGAAGAAAGG - Intergenic
977955787 4:103024072-103024094 GCTGCTAGGGAGCTCATGGCAGG - Intronic
981837830 4:149076222-149076244 CCTGCTAGGTTGCTGAGGGTTGG - Intergenic
982187783 4:152819863-152819885 TCTCCTAGGGAGCTCATTGCGGG + Intronic
982570397 4:157043290-157043312 ACTGCTGGGGTGCTGCTGACAGG + Intergenic
985988751 5:3538410-3538432 ACTGCCAGGGTGCTGCTGTCTGG - Intergenic
988538396 5:32088437-32088459 TCTCCAAGAGTGATGATGGCTGG - Exonic
991917118 5:71616134-71616156 TCTGCAAAGGTCCTGAGGGCTGG - Intronic
995536473 5:113141513-113141535 TTTGCTGGAGTGCTGAGGGCTGG + Intronic
996097623 5:119415415-119415437 TCTGATAGGGTGTTGATAGTGGG + Intergenic
997474851 5:134136908-134136930 TTTGCAAGGATGCTGTTGGCTGG - Intronic
998270101 5:140698745-140698767 TCTGCATGGGTGCAGATGGCTGG + Exonic
1001764057 5:174231229-174231251 TCATCTAGGGTGCAGATGGGAGG - Intronic
1002634827 5:180602077-180602099 CCAGCCAGGGTGCTGATGTCAGG + Exonic
1004056635 6:12145571-12145593 TCTGCTAGAGAGCTGAAGGCAGG - Intronic
1010210348 6:73357968-73357990 TTTGCTAGGATACTGAAGGCCGG + Intergenic
1015338987 6:132075828-132075850 GCAGCTAGTGTGCTCATGGCAGG + Intergenic
1015615547 6:135070637-135070659 TTTGCTACGGTGCCCATGGCTGG + Intronic
1017886002 6:158599889-158599911 TCTGCTTGGCTGCTGCTGACAGG + Intronic
1018095845 6:160386534-160386556 TCTGCTAGGTTGCTGTGGGAAGG + Intronic
1020139819 7:5606124-5606146 TCTGCCAAGGTGGTGGTGGCGGG + Exonic
1031839152 7:126716494-126716516 TCTCCTTGGGTGCTGAGGGTGGG + Intronic
1034694780 7:153043764-153043786 TCTGCAAGGGAGCTCAGGGCAGG - Intergenic
1036509470 8:9387153-9387175 GCTACTAGGGTGCTGATGTGAGG - Intergenic
1037808847 8:22074118-22074140 TCTGGTAGCTTGCTGTTGGCGGG + Intronic
1037874218 8:22531486-22531508 TCTGGCAGGGTGCTGAGGGTTGG + Intronic
1047525826 8:125633339-125633361 TTTGCAAGGGTGCTCCTGGCTGG + Intergenic
1052751175 9:32492510-32492532 TCTACTAAGGGGATGATGGCAGG - Exonic
1052815567 9:33100282-33100304 ACTGCTAGGGTGCTAAAGACAGG - Intergenic
1055127821 9:72739167-72739189 TCTCCCAGGTTGCAGATGGCTGG + Intronic
1057225087 9:93288955-93288977 TCTGGCATGGTGCTGGTGGCTGG - Exonic
1057472808 9:95372821-95372843 TCAGCTAGGATGCTTCTGGCTGG - Intergenic
1057706984 9:97401830-97401852 TCTGCTAGGGAGTTGAAAGCAGG - Intergenic
1057788287 9:98104989-98105011 TCTGCTATGGTGGCAATGGCAGG + Intronic
1058168271 9:101646441-101646463 TCAGGTAGTGTGCTGATGCCAGG + Intronic
1059511802 9:114855241-114855263 TCTGGAAGGGTCCAGATGGCAGG + Intergenic
1060004944 9:119991751-119991773 TCTGCTGGGGAGCTCCTGGCTGG - Intergenic
1061215313 9:129218364-129218386 CCTGCTGGGGGACTGATGGCAGG + Intergenic
1061368858 9:130186817-130186839 GCCGTGAGGGTGCTGATGGCGGG + Intronic
1062502846 9:136858655-136858677 TCTGCTCGGGCCCTGAGGGCTGG + Intronic
1189207875 X:39257317-39257339 TCTCTTAGGCTGGTGATGGCTGG + Intergenic
1190073959 X:47301905-47301927 TCTGCAAGGCTGCTGCTGTCAGG + Intergenic
1190706413 X:53031788-53031810 TCTGGAAGGGTGCTGAGTGCAGG - Intergenic
1192795637 X:74422225-74422247 TCTCCTAGGGTGCGGGTTGCGGG + Intronic