ID: 947467285

View in Genome Browser
Species Human (GRCh38)
Location 2:230362409-230362431
Sequence CAACATCCCCACATTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947467285 Original CRISPR CAACATCCCCACATTTAAAT GGG (reversed) Intronic
900960827 1:5918277-5918299 AAATATTCCCACATTTAAAAAGG - Intronic
907868531 1:58422123-58422145 CAACATCACCAGATTTCAAACGG - Intronic
909144639 1:71914591-71914613 CAACACCCCCACATTTCTCTAGG - Intronic
911302098 1:96186960-96186982 CCACAGCCCCACATTTTATTTGG + Intergenic
915678460 1:157554588-157554610 CAATATCCCCTCATTTATTTAGG + Intergenic
916262650 1:162857794-162857816 CAAGGTGCCCATATTTAAATTGG - Intronic
919260250 1:195183354-195183376 CAACCTCCCAACATTGAACTGGG - Intergenic
919681124 1:200435831-200435853 CAAGATGCCCACACTTAAACTGG - Intergenic
923959791 1:239066251-239066273 CAAAGTCCACTCATTTAAATGGG - Intergenic
924061212 1:240176553-240176575 GAACATCCCCACACTTAAAAAGG - Intronic
1064130402 10:12704402-12704424 CAACATGCCCACATTTATACTGG - Intronic
1065851103 10:29790257-29790279 CAAGATCCACACATTTTATTTGG + Intergenic
1069000898 10:63263156-63263178 CAACACCTCCACTATTAAATTGG + Intronic
1069163123 10:65114285-65114307 CACCATCCACACATTTCATTTGG - Intergenic
1070983903 10:80671780-80671802 AAGCTTCCCCACCTTTAAATGGG - Intergenic
1076183900 10:128431753-128431775 ATACATCCCCACATTTACAGAGG + Intergenic
1080868606 11:36216556-36216578 CAAAATCCTCACCTTTAAAATGG - Intronic
1080996176 11:37605013-37605035 CAACTTCCCAAAATTGAAATAGG + Intergenic
1081662450 11:44896381-44896403 CATCATCCCCACAGTACAATGGG - Intronic
1082197984 11:49326329-49326351 GAACATCACCAATTTTAAATCGG - Intergenic
1083873217 11:65504911-65504933 CCCAATCCCCACATTTAAAATGG - Intergenic
1084390082 11:68869705-68869727 CAGCAGCCTCACAGTTAAATGGG - Intergenic
1085442881 11:76579429-76579451 AAACATCCCCAAATCTCAATGGG + Intergenic
1086657832 11:89381795-89381817 GAACATCACCAATTTTAAATCGG + Intronic
1088281457 11:108139221-108139243 AAATTTTCCCACATTTAAATAGG + Intronic
1089029464 11:115309763-115309785 CCACATCCTCACCTATAAATGGG + Intronic
1090877322 11:130802328-130802350 CAACTGTCCAACATTTAAATTGG - Intergenic
1093598595 12:20993247-20993269 CAATATCCCTACATTTGAATGGG - Intergenic
1094551993 12:31461494-31461516 CTACTTCCAAACATTTAAATCGG - Intronic
1095728633 12:45479909-45479931 CAATATTCCCACTTTTTAATTGG - Intergenic
1096576609 12:52556726-52556748 CAACTTCCCCAGCTGTAAATGGG + Intergenic
1096741532 12:53697150-53697172 CAATCTCCCAACATTTTAATGGG - Intergenic
1098036865 12:66312165-66312187 TAACATCCCCACACTTCAACTGG - Intronic
1098107448 12:67084303-67084325 CAACACCCCCTTTTTTAAATTGG + Intergenic
1103170004 12:118809637-118809659 CAACATCCCAAGATTGAAAGAGG - Intergenic
1106718084 13:32412083-32412105 CAAGATCCCCACATTGTATTTGG + Intronic
1107033870 13:35880523-35880545 GAAAATCCCCACATCTCAATAGG - Intronic
1108381521 13:49859437-49859459 CATCATCCCATCATTGAAATTGG - Intergenic
1108446873 13:50518349-50518371 AGACATGCCCACATTTAAACTGG - Intronic
1108626303 13:52231992-52232014 CAACATCCACACATTTCATTTGG - Intergenic
1108659764 13:52574490-52574512 CAACATCCACACATTTCATTTGG + Intergenic
1108963969 13:56273064-56273086 AAAAAACCCCACATTTAAGTGGG - Intergenic
1110170623 13:72496323-72496345 CAACATCTTCCCATTTAAATTGG - Intergenic
1112043493 13:95572097-95572119 CAACATGCCCTGATTTTAATTGG + Intronic
1112149766 13:96745573-96745595 CACCATGCCCCCATTGAAATTGG + Intronic
1113208430 13:107944929-107944951 CAACATCCCAAGATTGAAATAGG + Intergenic
1114567828 14:23645454-23645476 CAAGAACCCCACATGTTAATTGG - Exonic
1120460969 14:84794609-84794631 CAACATCCCCAAAATTAATCTGG - Intergenic
1126483839 15:49157135-49157157 CATCATACCAACTTTTAAATTGG + Intronic
1128214626 15:65925703-65925725 CCCCACCCCCACATCTAAATTGG + Intronic
1129037564 15:72659950-72659972 CAACATCCTCACATTGGAAAAGG + Exonic
1129212323 15:74077275-74077297 CAACATCCTCACATTGGAAAAGG - Exonic
1129398074 15:75263804-75263826 CAACATCCTCACATTGGAAAAGG + Exonic
1129401685 15:75288085-75288107 CAACATCCTCACATTGGAAAAGG + Exonic
1129729453 15:77921593-77921615 CAACATCCTCACATTGGAAAAGG - Intergenic
1133761055 16:8798433-8798455 CAACATCTACAGCTTTAAATGGG + Intronic
1135199302 16:20423002-20423024 CAACATCTCCACTTTTAACAAGG - Intronic
1135219396 16:20600641-20600663 CAACATCTCCACTTTTAACAAGG + Intergenic
1138256591 16:55569157-55569179 CAACCTCTCCACATTTCACTGGG - Intronic
1141521163 16:84580607-84580629 TAAAAGCCCCACATTTAAAGTGG + Intronic
1147033653 17:37662885-37662907 CATCATCTCCACATGTTAATTGG + Intergenic
1147046179 17:37754175-37754197 CACCATTCCCACCTTTAAAACGG + Intergenic
1148648480 17:49232781-49232803 CAACATCCCAACATTTTGGTAGG - Intergenic
1150444115 17:65215252-65215274 CCACATCACCCCATTTCAATCGG - Intronic
1151422165 17:74005686-74005708 CACCATCCCCACTTTTCAGTAGG - Intergenic
1154956426 18:21261464-21261486 CAACTTCCCTACAATAAAATAGG + Intronic
1157209910 18:45733321-45733343 CAACATGCACATAATTAAATGGG + Intronic
1166249004 19:41552812-41552834 CAACAGCAACACATATAAATAGG + Intronic
926838629 2:17052808-17052830 CAACATGCCCACAGCTACATGGG - Intergenic
926841034 2:17080421-17080443 CAAAATCCCCACATGTCCATGGG + Intergenic
927336105 2:21926321-21926343 CATCATCCCCACAATTGAAAGGG + Intergenic
927594175 2:24382401-24382423 CAAAATCCAAAGATTTAAATAGG + Intergenic
930161430 2:48161337-48161359 CACCATGCCCACTTTTTAATGGG - Intergenic
931153358 2:59599632-59599654 CATCAACACCACATTTAAAGAGG + Intergenic
931431201 2:62210355-62210377 GAACATCCCAACATTAAAAATGG + Intronic
934628272 2:95883957-95883979 AGACTTCCCCACATTGAAATTGG - Intronic
934629037 2:95895186-95895208 ACACATCCCCACATTGCAATTGG - Intronic
934629451 2:95900802-95900824 ACACATCCCCACATTGCAATTGG - Intronic
934629866 2:95906418-95906440 ACACATCCCCACATTGCAATTGG - Intronic
934630271 2:95912031-95912053 ACACATCCCCACATTGCAATTGG - Intronic
934630548 2:95915767-95915789 ACACATCCCCACATTGCAATTGG - Intronic
934631090 2:95923278-95923300 AGACTTCCCCACATTGAAATTGG - Intronic
934631343 2:95927006-95927028 AGACTTCCCCACATTGAAATTGG - Intronic
934802694 2:97181978-97182000 AGACTTCCCCACATTGAAATTGG + Intronic
934802955 2:97185705-97185727 AGACTTCCCCACATTGAAATTGG + Intronic
934803085 2:97187608-97187630 ACACTTCCCCACATTGAAATTGG + Intronic
934803223 2:97189496-97189518 ACACTTCCCCACATTGAAATTGG + Intronic
934803494 2:97193247-97193269 ACACTTCCCCACATTGAAATTGG + Intronic
934803921 2:97198852-97198874 ACACTTCCCCACATTGAAATTGG + Intronic
934804337 2:97204457-97204479 ACACTTCCCCACATTGAAATTGG + Intronic
934804612 2:97208200-97208222 ACACTTCCCCACATTGAAATTGG + Intronic
934805008 2:97213809-97213831 AGACTTCCCCACATTGAAATTGG + Intronic
934832228 2:97539816-97539838 AGACTTCCCCACATTGAAATTGG - Intronic
934832475 2:97543571-97543593 AGACTTCCCCACATTGAAATTGG - Intronic
934832724 2:97547320-97547342 ACACTTCCCCACATTGAAATTGG - Intronic
934833121 2:97552940-97552962 ACACTTCCCCACATTGAAATTGG - Intronic
934833245 2:97554842-97554864 AGACTTCCCCACATTGAAATTGG - Intronic
935423259 2:102892857-102892879 CAGCAGCCCCACATTTGACTGGG + Intergenic
935823609 2:106918910-106918932 AAACAACCCAACTTTTAAATGGG + Intergenic
937431894 2:121845794-121845816 CACCATCCCCACTTTGAATTTGG - Intergenic
938621732 2:133061927-133061949 CAACATGCCCACATTTTTTTTGG + Intronic
940348580 2:152654923-152654945 CAAAATCCCAACTTTGAAATAGG + Exonic
942489017 2:176471092-176471114 CAACGTGCCCACATTTAATTTGG + Intergenic
945296307 2:208174617-208174639 CAATTTCCCCATATGTAAATAGG - Intronic
945994838 2:216427535-216427557 CAACATACTCAGATTTAATTTGG + Intronic
947467285 2:230362409-230362431 CAACATCCCCACATTTAAATGGG - Intronic
947489726 2:230583215-230583237 CAACATGTCCACGTTTAAATTGG + Intergenic
1168790062 20:570017-570039 CTAAATCCCCACATAAAAATTGG - Intergenic
1171276857 20:23863796-23863818 CACCATGCCCACTTTTTAATGGG + Intergenic
1173916657 20:46713067-46713089 CTACATCCCCACAGTTCATTTGG + Intronic
1174337433 20:49873184-49873206 CAAAATCCACACATTTAGCTGGG + Intronic
1175546731 20:59783028-59783050 CACCCTCCCCACACTTAAAATGG - Intronic
1177220974 21:18192554-18192576 CAACATCAACACATTTACATAGG + Intronic
1182150652 22:28024884-28024906 CTACATGCCCACATTTAATGTGG + Intronic
1182187069 22:28416050-28416072 CAACATTTCGACATTAAAATTGG + Intronic
1184525496 22:45020295-45020317 CAAATTCTCCACCTTTAAATTGG + Intergenic
949661749 3:6287051-6287073 CAACCTCCCAAGATTTAACTAGG + Intergenic
950991080 3:17438377-17438399 CATAATCCCCACATATCAATGGG + Intronic
955936565 3:64108394-64108416 CAACATCCCGAACTTCAAATTGG + Intronic
957855145 3:85865364-85865386 CAACATACACACATTTTATTTGG - Intronic
958952869 3:100435375-100435397 CCAATTCCCCACATGTAAATGGG + Intronic
959268135 3:104169746-104169768 CAGCATCCCCACAGGTAAAGAGG - Intergenic
960333214 3:116388065-116388087 GAATATACCCACATTTGAATTGG + Intronic
961099481 3:124186364-124186386 CAGCATTCCCAAATGTAAATAGG + Intronic
962872945 3:139513847-139513869 AAAAAACCCCACATGTAAATCGG + Intergenic
964091633 3:152884019-152884041 CACTCTTCCCACATTTAAATTGG + Intergenic
969213200 4:5703866-5703888 CAACATAACCCCATTTAAAATGG - Intronic
969327436 4:6452076-6452098 CAACCTCCCCACACTTACACAGG - Intronic
969454202 4:7291906-7291928 AAACATCCCCACAGTAAAACTGG + Intronic
971457459 4:26858112-26858134 CAGTTTCCCCACTTTTAAATTGG - Intronic
971640904 4:29131532-29131554 CAACCTGCCCAGATTAAAATAGG + Intergenic
972074248 4:35064494-35064516 CAACATCCACACAACTAAAATGG - Intergenic
972854202 4:43086915-43086937 TAACATCAACACATTTAAAAAGG + Intergenic
975842833 4:78493698-78493720 CATCAACCCGTCATTTAAATTGG - Intronic
978214708 4:106185619-106185641 CAACACCCTCACATGTTAATGGG + Intronic
978876677 4:113648123-113648145 CAACTACCCCAATTTTAAATAGG - Intronic
979348287 4:119615217-119615239 CAACTTCCTCATTTTTAAATAGG + Intronic
979674876 4:123399073-123399095 CGACTTCCCCACTTTTAAAGTGG - Intronic
981112551 4:140952406-140952428 CTACATGCCCACATTTAAGAAGG - Intronic
981138724 4:141241623-141241645 AAACATTCCTACATTTAAGTAGG - Intergenic
988026293 5:25694963-25694985 CATCCTACCCACATTTACATGGG - Intergenic
989301614 5:39901831-39901853 AAACCTCCCCACACTTATATAGG + Intergenic
989435600 5:41409791-41409813 CAACATCCTCATCTATAAATAGG + Intronic
990220564 5:53583956-53583978 CAACATCCCAAGATTGAAAAGGG - Intronic
992855379 5:80855531-80855553 CAGCATCCTCAGATCTAAATTGG + Intronic
993094406 5:83464871-83464893 CAACAGCCCCACATTACAATTGG + Intergenic
994336551 5:98573464-98573486 CAACATTCCCCCATTTCATTAGG + Intergenic
995629742 5:114120295-114120317 CAACAGCCCCAGAATAAAATAGG - Intergenic
996361980 5:122658695-122658717 CAAAATCCACACCTTTAAAAGGG + Intergenic
998752940 5:145343940-145343962 CAACATACCAAGATTGAAATAGG + Intergenic
999834682 5:155356577-155356599 CAACCTCCCAAGATTTAAACAGG + Intergenic
1000625730 5:163535922-163535944 TAACATGCCCAAATTTACATGGG - Intergenic
1000936075 5:167303965-167303987 TAAAATCCCCAGATTTAAAATGG + Intronic
1001859710 5:175043198-175043220 CTACATCTCCACATTTAGCTAGG - Intergenic
1012974248 6:105762958-105762980 CAACAACCCCTCATCTACATTGG - Intergenic
1013653568 6:112222217-112222239 GAAATTCCCCACATTTTAATAGG + Intronic
1015079845 6:129210424-129210446 CACCAACCACACATTTACATTGG + Intronic
1021870940 7:25005388-25005410 CAATATTCCCACATAAAAATGGG + Intergenic
1022620715 7:31981238-31981260 TCACATCCCCAGATTTATATAGG - Intronic
1024626204 7:51210259-51210281 CCACCTGCCCAAATTTAAATTGG + Intronic
1024677776 7:51652889-51652911 CAATATCCTCATATTTAAAATGG + Intergenic
1024906516 7:54388285-54388307 CAACAGCAACACATATAAATAGG + Intergenic
1024978083 7:55132084-55132106 AAACATACACACATTTACATTGG - Intronic
1025838593 7:65121982-65122004 CAACATCCAAACCTTAAAATAGG + Intergenic
1025878680 7:65511116-65511138 CAACATCCAAACCTTAAAATAGG - Intergenic
1025884479 7:65574000-65574022 CAACATCCAAACCTTAAAATAGG - Intergenic
1026581353 7:71621104-71621126 CAGCATTCCCATATTTTAATTGG + Intronic
1029000249 7:97146210-97146232 AAACATCAGCACATTTAAAAAGG - Intronic
1032873075 7:136007282-136007304 TAACATGCCCAAGTTTAAATTGG + Intergenic
1033772993 7:144574450-144574472 CAACATCCACACGTTGCAATTGG - Intronic
1038468630 8:27790830-27790852 CCAAATTCCCACATATAAATGGG + Intronic
1042373759 8:68023454-68023476 AAACATCCCAATTTTTAAATGGG - Intronic
1043918672 8:85955176-85955198 ACACATCCTCACTTTTAAATGGG + Intergenic
1044245726 8:89942885-89942907 CACAATCCCCAGATTTAAAAAGG + Intronic
1044859848 8:96512228-96512250 AAACATCCCCAGATTTTAGTTGG - Intronic
1048226651 8:132594260-132594282 CATAATCCCCACATTTAGATAGG + Intronic
1048965425 8:139611285-139611307 CAGTTTCCCCACCTTTAAATTGG - Intronic
1049963423 9:757496-757518 CAACTAGCACACATTTAAATGGG + Intergenic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1052372619 9:27682799-27682821 CAATATTCCCACATTTAAAATGG + Intergenic
1052554260 9:29993384-29993406 ACACAACCCCACATTTAATTTGG - Intergenic
1055424274 9:76177702-76177724 CAACATTCCAAAATTTGAATGGG - Intronic
1056014757 9:82372592-82372614 CAACATTTACATATTTAAATAGG - Intergenic
1057347763 9:94266501-94266523 CAACAGCAACACATATAAATAGG + Intronic
1059088196 9:111327687-111327709 CAAAATCACCACAGTCAAATGGG + Exonic
1059740180 9:117142456-117142478 CAACATCCCCTCAATAAAATGGG - Intronic
1060245532 9:121942880-121942902 CAACATCCCCTCATTCAAGAAGG + Intronic
1203582828 Un_KI270746v1:28384-28406 ACACTTCCCCACATTGAAATTGG + Intergenic
1185794790 X:2955713-2955735 AAACATCAACTCATTTAAATAGG + Intronic
1188167613 X:26880915-26880937 CAACAGCAACACATATAAATAGG + Intergenic
1188172791 X:26948663-26948685 CAACCTCCCAAGATTGAAATAGG - Intergenic
1192756658 X:74053259-74053281 CAACATCCCAACATTGAACGAGG + Intergenic
1193079105 X:77388239-77388261 CAAAATCCGCACATTTACAGTGG + Intergenic
1193946443 X:87742045-87742067 CAATTTCCACACATTTTAATTGG - Intergenic
1194813326 X:98413591-98413613 CAACTTCCTTACATTTACATGGG - Intergenic
1194902239 X:99526807-99526829 TCACTTGCCCACATTTAAATGGG - Intergenic
1197163493 X:123349964-123349986 CAACATAGCCAAATGTAAATAGG + Intronic
1197327081 X:125107459-125107481 CTATATTGCCACATTTAAATGGG + Intergenic
1197565216 X:128075559-128075581 CAACTTCCCAAGATTAAAATAGG + Intergenic
1199328234 X:146527362-146527384 CATCATCCTCACATTTGAAGAGG + Intergenic
1199347292 X:146756665-146756687 GAACATCCGCACACTTTAATTGG + Intergenic
1202029148 Y:20553496-20553518 CAATAGCCCCTCATTTAAAGTGG - Intergenic