ID: 947472421

View in Genome Browser
Species Human (GRCh38)
Location 2:230411733-230411755
Sequence CGGGCTGAACAGAGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947472408_947472421 13 Left 947472408 2:230411697-230411719 CCAGGAGGAGCGAAGGGCAGAGT No data
Right 947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG No data
947472411_947472421 -10 Left 947472411 2:230411720-230411742 CCCCCGCCCCTCACGGGCTGAAC No data
Right 947472421 2:230411733-230411755 CGGGCTGAACAGAGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947472421 Original CRISPR CGGGCTGAACAGAGGGCAGG CGG Intergenic
No off target data available for this crispr