ID: 947472787

View in Genome Browser
Species Human (GRCh38)
Location 2:230413845-230413867
Sequence CCATTGCCCCACAGAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947472781_947472787 17 Left 947472781 2:230413805-230413827 CCTATGCAAAAAACAACTATACA 0: 1
1: 0
2: 3
3: 27
4: 342
Right 947472787 2:230413845-230413867 CCATTGCCCCACAGAAAAGGTGG 0: 1
1: 0
2: 3
3: 9
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947472787 Original CRISPR CCATTGCCCCACAGAAAAGG TGG Intergenic
900982585 1:6054871-6054893 CGTCTGCCACACAGAAAAGGGGG + Intronic
901023176 1:6265326-6265348 CCATTGCCCCAGCGAGAAGTGGG + Intronic
901850247 1:12010526-12010548 CCATTTACCCACAGAGAAGCTGG + Intronic
902548672 1:17206350-17206372 CCACTGCCCAACAGAGAAGCAGG - Intronic
902898513 1:19496556-19496578 CCATGGCAACACAGAACAGGGGG - Intergenic
905127871 1:35728431-35728453 CCATTGCCCAAAAGAAAACTGGG + Intronic
905923699 1:41735431-41735453 CATTTTCCCCACAGACAAGGGGG - Intronic
907708423 1:56853091-56853113 ACACTGCCCCACAGAAAAACTGG - Intergenic
912243606 1:107938187-107938209 CAATTACCCTACAGAAGAGGAGG + Intronic
915570418 1:156742447-156742469 CCAGTGCACCTCAGAAATGGGGG + Intronic
919069797 1:192739564-192739586 CATCTGCCCCGCAGAAAAGGTGG - Intergenic
919639416 1:200034562-200034584 CCCTTGCCCCAGAGGAAAGGAGG - Intronic
920965358 1:210696633-210696655 CCAGTGCCCCCCATAAAATGAGG - Intronic
922336359 1:224621621-224621643 CCATTGCCCCACAGCTGAAGTGG + Intronic
923677009 1:236088780-236088802 CCACTGCCCCTCAGAAAACCCGG + Intergenic
1065131094 10:22621102-22621124 CCATTGATGCACAGAAAAGACGG + Intronic
1066556887 10:36624015-36624037 ACATAGCCCTACAGAAAATGTGG - Intergenic
1066578895 10:36858429-36858451 CCAGAGTCCCACATAAAAGGGGG + Intergenic
1070628694 10:78069129-78069151 CCATGCCCCCACACAGAAGGTGG - Intergenic
1072718890 10:97768833-97768855 CCCTGGCCCCACAGAGATGGGGG - Intronic
1074232945 10:111555712-111555734 CCATTTCCCCACAGAAACAGAGG + Intergenic
1075547419 10:123365513-123365535 CCCTTGCCTCTCAGCAAAGGTGG + Intergenic
1077343393 11:2035894-2035916 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1077660142 11:4060528-4060550 CCACTCCCCCAAAAAAAAGGTGG - Intronic
1078387848 11:10908621-10908643 CATCTGCCACACAGAAAAGGTGG - Intergenic
1085581659 11:77656414-77656436 CAACTGCCCAGCAGAAAAGGTGG - Intergenic
1085721094 11:78912996-78913018 CAATTGACAAACAGAAAAGGAGG + Intronic
1090409350 11:126496949-126496971 CCATTTCCCTACAGCAAGGGTGG - Intronic
1202826379 11_KI270721v1_random:91083-91105 CAGTTGCCCTTCAGAAAAGGAGG - Intergenic
1091786354 12:3245428-3245450 CCTTTGCAGCACACAAAAGGGGG - Intronic
1091828167 12:3530878-3530900 CCATAGCCCCACAAAAGAGGCGG + Intronic
1092019277 12:5187296-5187318 CCAATGCCGCAAAGAAATGGAGG + Intergenic
1092780534 12:11982208-11982230 CCATGGCCCCACAGAATTGGTGG + Intergenic
1096606445 12:52769737-52769759 CCATATCTCCCCAGAAAAGGGGG + Intronic
1096767239 12:53901713-53901735 CTATTGGCACACAGAAGAGGGGG - Intergenic
1096773490 12:53950738-53950760 CGATTGCCTCTCAGAAAATGCGG - Intergenic
1097860895 12:64517569-64517591 CCACTTCCACACAGAAAAGTAGG + Intergenic
1098504983 12:71238907-71238929 CCACTGACCTATAGAAAAGGTGG - Intronic
1098605990 12:72390350-72390372 CCAAAGCCCCAGAGAAAGGGAGG + Intronic
1099059525 12:77889036-77889058 CCATTGCACCACACAAAAGGTGG - Intronic
1102529604 12:113536655-113536677 CCCTTGCCCCCCACAAAAGAGGG - Intergenic
1104373206 12:128242642-128242664 CCATTGCCCATAAGGAAAGGAGG + Intergenic
1107048959 13:36027165-36027187 CAATTTTCCCACAGAAATGGGGG + Intronic
1107094451 13:36519630-36519652 CCGTTTCCCCACTGAGAAGGTGG + Intergenic
1109177522 13:59174429-59174451 CCCTTCCCCCACAAAAAAAGAGG + Intergenic
1109704202 13:66067984-66068006 CCAATTCCCCACAGATATGGAGG + Intergenic
1110763122 13:79252445-79252467 CCCTTGCCCCACTGTAAAGCAGG - Intergenic
1112442020 13:99431544-99431566 CCATCACTCCACAGACAAGGAGG - Intergenic
1112448312 13:99487415-99487437 CATATGCCACACAGAAAAGGTGG + Intergenic
1112552694 13:100436464-100436486 CATCTGCCACACAGAAAAGGTGG + Intronic
1112638596 13:101245804-101245826 CATCTGCCGCACAGAAAAGGTGG - Intronic
1112731635 13:102369262-102369284 CCACTGCAGCACAGAAAAAGTGG + Intronic
1113878572 13:113609506-113609528 CCACTTCCCCACAGAAGATGAGG - Intronic
1114661871 14:24351591-24351613 ACATATCCCCACAGATAAGGGGG + Intergenic
1117461992 14:55954557-55954579 CAAATACCACACAGAAAAGGTGG + Intergenic
1120433991 14:84456853-84456875 TCAATGCCCCACAGGAAGGGAGG + Intergenic
1121429348 14:93875901-93875923 CATCTGCCTCACAGAAAAGGTGG - Intergenic
1123699303 15:22902785-22902807 CCACGGCCCCACAGGAAACGCGG + Intronic
1123919012 15:25057507-25057529 ACAGTACCCCAGAGAAAAGGTGG + Intergenic
1126606796 15:50486175-50486197 CCATTTCTCCACAGAAAGAGGGG + Intronic
1127704359 15:61532595-61532617 CCCCTGCCCCCCAAAAAAGGGGG - Intergenic
1128532681 15:68465270-68465292 CCAGTGCCCTGCAGAAGAGGTGG + Intergenic
1128921436 15:71613831-71613853 CCTATACCCCACATAAAAGGAGG - Intronic
1131314522 15:91321984-91322006 ACAATGACCCACAGAAAAGATGG - Intergenic
1131591964 15:93759645-93759667 GCCTTGCCCCTCAGAAAAGCTGG + Intergenic
1132573308 16:653433-653455 CCTTGGCCACACAGACAAGGTGG + Exonic
1132779884 16:1617377-1617399 CCATTACCCGTCAGAAAAGAAGG + Intronic
1133075196 16:3274805-3274827 CATCTGCCCCTCAGAAAAGGTGG + Intronic
1134073906 16:11277289-11277311 TGTTTGCCCCACAGAAAATGAGG - Intronic
1134098655 16:11436256-11436278 CAACTCCTCCACAGAAAAGGAGG + Intronic
1136270382 16:29144992-29145014 CCATTGCCGCACAGGCCAGGAGG + Intergenic
1136607768 16:31348165-31348187 CCACTGCCACACAGAAGAAGGGG - Intergenic
1137792238 16:51184952-51184974 CCATTGCCACCCAGAAAGAGAGG - Intergenic
1142073968 16:88106801-88106823 CCATTGCCGCACAGGCCAGGAGG + Intronic
1143610046 17:8012900-8012922 GCCTTGCCCTTCAGAAAAGGTGG - Intronic
1143693760 17:8594640-8594662 CCAATCCCCCACAGATAACGGGG - Intronic
1144947532 17:18977589-18977611 CCAGCGCTCCACAGACAAGGAGG - Exonic
1147982035 17:44280663-44280685 CCTTTACCCCACAGCAGAGGAGG - Intergenic
1148974191 17:51512387-51512409 CATCTGCCGCACAGAAAAGGGGG - Intergenic
1152036958 17:77879543-77879565 CTAGAGCCCCACAGAGAAGGTGG + Intergenic
1152899468 17:82931785-82931807 TATTTACCCCACAGAAAAGGAGG - Intronic
1154294757 18:13138322-13138344 CTTCGGCCCCACAGAAAAGGTGG + Intergenic
1155517602 18:26639096-26639118 ACATCTCCCCACAGAAAAGCTGG + Intronic
1156097299 18:33551091-33551113 CCTTTACCCCACAGGAGAGGTGG - Intergenic
1156201544 18:34838149-34838171 CCTTTGCCCTTCAGAAAAGCTGG - Intronic
1157967260 18:52222357-52222379 CCAGAGCCCCACAGGAATGGGGG - Intergenic
1158266337 18:55664637-55664659 CATCTGCCTCACAGAAAAGGGGG - Intronic
1158402425 18:57133160-57133182 CCTGTGCCCCAGAGAATAGGGGG + Intergenic
1159258818 18:65983688-65983710 CCTATTCCCCACAGATAAGGTGG + Intergenic
1159929120 18:74294083-74294105 AGATGGCTCCACAGAAAAGGAGG - Intergenic
1160820617 19:1056052-1056074 GCATGGCCCCACAGATACGGAGG + Exonic
1161853722 19:6752464-6752486 CCTGTGCCTCACAGAAGAGGTGG - Exonic
1162198164 19:9001781-9001803 CCATTGCACTCCAGAAAAGAAGG - Intergenic
1164870360 19:31638436-31638458 TCATTGCCTCAAAGAAGAGGTGG + Intergenic
1165387544 19:35519676-35519698 CCATTTCCCCCCAGACAAAGAGG - Intergenic
1166002902 19:39888859-39888881 CCATAGTCCCCCAGCAAAGGTGG - Intronic
1166005689 19:39905111-39905133 CCATAGTCCCCCAGCAAAGGTGG - Intronic
1166130763 19:40744349-40744371 CCATGGCCCCAGCGAAGAGGTGG + Intronic
1167034429 19:46985789-46985811 CCTTTCCCCGAGAGAAAAGGAGG - Intronic
1167747095 19:51358243-51358265 CCACAGCCCCAGAGAAAAAGGGG - Intronic
1168259956 19:55187762-55187784 CCAGTGCCCCACAGGGCAGGTGG - Intronic
930003958 2:46881507-46881529 CCATTCCCCCAGGGAAAGGGAGG + Intergenic
932424543 2:71620749-71620771 TCTTTGCCTCACTGAAAAGGAGG + Intronic
933310154 2:80650838-80650860 CCATTACCCAATAGGAAAGGTGG + Intergenic
933660654 2:84924833-84924855 CGTCGGCCCCACAGAAAAGGGGG - Intergenic
939039734 2:137173642-137173664 CCATTGCCCCACAAACGATGAGG - Intronic
942532257 2:176923705-176923727 CCATTGTCCAGCAGTAAAGGTGG + Intergenic
943767683 2:191679216-191679238 AGAGTGGCCCACAGAAAAGGCGG - Intronic
944250860 2:197579258-197579280 CAATTGCCCCCCAGGCAAGGTGG - Intronic
944682301 2:202088191-202088213 CCAATTCCCCACAGATAACGAGG + Intronic
946871988 2:224092625-224092647 TCCTTGCCCCCCAGAAAAGCAGG + Intergenic
947472787 2:230413845-230413867 CCATTGCCCCACAGAAAAGGTGG + Intergenic
1170684456 20:18556377-18556399 CCATTCCCCCACAGATACTGAGG + Intronic
1172214388 20:33224797-33224819 CCACTGCCCCCAAGAAAGGGAGG + Intronic
1173485606 20:43438745-43438767 CATCTGCCCCGCAGAAAAGGTGG - Intergenic
1175181222 20:57149033-57149055 CCATAGCCCCACGGAAAAGCTGG + Intergenic
1180672887 22:17566840-17566862 CCATTGCCCACCAGAAAAGGTGG + Intronic
1181933293 22:26420380-26420402 CCACTGCCCCAAATAAAAGTTGG - Intergenic
1182819696 22:33204725-33204747 CCATTTTCACACAGCAAAGGTGG + Intronic
1182835259 22:33336701-33336723 CCATGGCCCCACAGGAAACAAGG - Intronic
1184408446 22:44313277-44313299 CCATTGCCCAACAGAGACTGAGG - Intergenic
950217347 3:11168929-11168951 CCATAGCCCCACAGAGCAGTGGG + Intronic
950410148 3:12830835-12830857 CCTAAGCCCCACAGCAAAGGAGG - Intronic
950748635 3:15110832-15110854 CCATTATCCCACAGATAAAGAGG - Intergenic
950981420 3:17310602-17310624 CCATTGCTTCTCAGTAAAGGTGG - Intronic
951857080 3:27209671-27209693 CCTTAGTCCCACAGCAAAGGTGG + Intronic
954512460 3:51138041-51138063 CCATTGCCTTACACAAAAGTGGG + Intronic
956390236 3:68764229-68764251 CCATACCCCCACAGAGAAAGAGG + Intronic
956742061 3:72282896-72282918 CTATTGCCCCACTGAGAAGTGGG + Intergenic
963530984 3:146473046-146473068 ACAGTACCCCAGAGAAAAGGAGG - Intronic
964545301 3:157827777-157827799 CCTGCGCTCCACAGAAAAGGAGG - Intergenic
967170154 3:186816832-186816854 CACATCCCCCACAGAAAAGGGGG - Intergenic
967235905 3:187383362-187383384 CCATGGCCCCCCAGAAAAGGTGG - Intergenic
967286211 3:187873019-187873041 CCCTCACCCCCCAGAAAAGGTGG - Intergenic
969698020 4:8746263-8746285 CCAATGACCCAAAGAAGAGGAGG - Intergenic
970974433 4:22026951-22026973 CCATAGAACCACAGAACAGGTGG + Intergenic
976814684 4:89133908-89133930 CGTCTGCCACACAGAAAAGGTGG + Intergenic
977867559 4:102047903-102047925 CCATCTGCCCACAGAAAAAGGGG + Intronic
978419079 4:108511062-108511084 CCCTTTCCACACAGAAGAGGAGG - Intergenic
979724923 4:123949540-123949562 TTAGTGCCTCACAGAAAAGGAGG - Intergenic
984689689 4:182712391-182712413 GAATTGCCCCACTGACAAGGAGG - Intronic
986516073 5:8565200-8565222 TCATTGACCCACAGAAAACATGG - Intergenic
986735230 5:10663113-10663135 CCCATGCCCCACAGCCAAGGCGG - Intergenic
987734377 5:21821002-21821024 TCATTTTCCCATAGAAAAGGAGG + Intronic
989102425 5:37835172-37835194 CGATTGCCCCCCAGGAATGGGGG - Intronic
990534189 5:56704016-56704038 CCACTGCCCCAGAGAAAACTTGG + Intergenic
990650144 5:57888959-57888981 CAATTGCCCCAGAGAAAACTGGG - Intergenic
990704730 5:58515409-58515431 CCACTGAACCACAGAAATGGTGG - Intergenic
997235205 5:132268488-132268510 CTATCGCCCCACAGGGAAGGTGG - Intronic
997434117 5:133861922-133861944 CCAGTCCCCCCCAGAAAATGAGG + Intergenic
998175904 5:139902025-139902047 CCAGAGACCCACAGAAAGGGAGG + Intronic
999370830 5:151054225-151054247 CCCCTGCCACACAGAATAGGAGG + Intronic
999548778 5:152660914-152660936 TCATTCCCCCACAGAAACTGAGG + Intergenic
1000861029 5:166456347-166456369 CCCTTGGCCCTCAGAAAAGAAGG + Intergenic
1000871152 5:166579060-166579082 CCAATGCCCCACAGACACTGAGG - Intergenic
1004724275 6:18296112-18296134 CCACTGCACCACAGAACATGTGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005322532 6:24668882-24668904 CATCTGCCACACAGAAAAGGTGG + Intronic
1006295443 6:33168122-33168144 CCCCTGGCCCACAGAAAAGCTGG + Intronic
1006756732 6:36422895-36422917 CCATTCCCGCACAGCAATGGTGG + Intronic
1006918862 6:37614563-37614585 TCATTCCCCCACATAGAAGGAGG - Intergenic
1006929215 6:37677772-37677794 CCATAGCAGCACAGAAAGGGAGG + Intronic
1007990920 6:46255180-46255202 CCATTTCCCCCCAGGAGAGGAGG + Intronic
1008220286 6:48845760-48845782 AAATTGGCCCACAGAAAATGTGG - Intergenic
1008366987 6:50692786-50692808 CCAGTGATTCACAGAAAAGGGGG - Intergenic
1008617972 6:53244568-53244590 TCATTGACCCACATAAAATGGGG + Intergenic
1012851226 6:104447973-104447995 CAATTTCCCATCAGAAAAGGTGG + Intergenic
1014629988 6:123776884-123776906 CCAGTCCCCCACAGATACGGAGG - Intergenic
1016609650 6:145974085-145974107 ACAGTACCCCACAGGAAAGGAGG - Intergenic
1020926100 7:14326644-14326666 CCATTCCCGCAAAGGAAAGGAGG - Intronic
1023164259 7:37327693-37327715 CCATTGCCACTCAAGAAAGGAGG - Intronic
1024625225 7:51202540-51202562 CAAATCCCCCACAGAAAGGGAGG + Intronic
1024933996 7:54693276-54693298 CCAATCCCCCACAGATAATGAGG + Intergenic
1026990240 7:74581011-74581033 CCAACCCCCCCCAGAAAAGGGGG - Intronic
1028814539 7:95129513-95129535 CTAATACCCCACAGAAAAAGTGG + Intronic
1029219036 7:98973529-98973551 CCATGGCCCCACAGAGGACGTGG - Intronic
1030489372 7:110212878-110212900 CCAATGCCCTACAGAAACAGAGG + Intergenic
1030764899 7:113396612-113396634 CCTTATCCCCACAGAAAAGAGGG - Intergenic
1035061904 7:156075483-156075505 CTAGTGCCCCACAGAACAAGGGG - Intergenic
1036805278 8:11827624-11827646 CAACTGCCCCACAGAAAAATGGG + Intronic
1039720283 8:40157118-40157140 CCCCTGGCCCACAGCAAAGGGGG + Intergenic
1040516128 8:48136537-48136559 CCCTTGCCCCTCAGACATGGAGG + Intergenic
1042844169 8:73153884-73153906 CCTATGCTACACAGAAAAGGGGG + Intergenic
1044307098 8:90650391-90650413 CCATAGCCACACAGAGAAAGTGG + Intronic
1044528048 8:93274693-93274715 ACACTGCCCCACAGAAATGGAGG + Intergenic
1046011680 8:108556186-108556208 CCATTGTCCATCAAAAAAGGAGG + Intergenic
1047417885 8:124680482-124680504 GCATTACCCCAAGGAAAAGGTGG + Intronic
1047794319 8:128238690-128238712 CCTTTGCTCCATAGAAAATGGGG - Intergenic
1047984651 8:130220217-130220239 TCATTTCCCCACAGAAATGCTGG - Intronic
1049140668 8:140950911-140950933 CCAATCCCCCACAGATATGGAGG + Intronic
1049653632 8:143788314-143788336 CCCCTGCTCCACAGACAAGGAGG + Intergenic
1050054222 9:1635135-1635157 CCATTGCACCACAGAGAAAATGG + Intergenic
1051131028 9:13861192-13861214 CCTTTGCCACACATAAAAGGGGG + Intergenic
1051288530 9:15521514-15521536 ACAATCCCCCACAGATAAGGAGG + Intergenic
1053200872 9:36150858-36150880 TCATTTCCACACAGGAAAGGAGG + Exonic
1053320048 9:37089495-37089517 CCAATGCCCCACAGATACTGAGG - Intergenic
1055174858 9:73305247-73305269 ACATTTCCCCGCAGATAAGGGGG - Intergenic
1056456110 9:86762557-86762579 CTAAAGCCCCACAGAAAAAGAGG - Intergenic
1057577250 9:96253022-96253044 CCATTGCCCCAAATAAAAATGGG + Intronic
1057912440 9:99030508-99030530 CCATTGACTCACAGATAAGATGG - Intronic
1058760098 9:108122232-108122254 CATCTGCCACACAGAAAAGGTGG - Intergenic
1059143376 9:111875293-111875315 TCTTTTCCCCACAGAAAAGAGGG - Intergenic
1060848600 9:126857110-126857132 CCGTTGCTACACAGACAAGGAGG + Intergenic
1061175550 9:128994097-128994119 CAAAAGCCCCACAGAAGAGGAGG - Intronic
1061554400 9:131358036-131358058 CCCTTCCCCCACAGAAGATGAGG + Intergenic
1203775293 EBV:69579-69601 CCATCGCCCCACAGAGAAAGAGG - Intergenic
1186278181 X:7962999-7963021 ACATTGCCCCACAGAACCGGGGG - Intergenic
1192119214 X:68439047-68439069 CATCTGCCCCTCAGAAAAGGTGG - Intergenic
1192248589 X:69392597-69392619 CCATTTGCCCACAGGAAAGAAGG + Intergenic
1194475905 X:94359930-94359952 GCAGAGGCCCACAGAAAAGGTGG + Intergenic
1194585690 X:95731175-95731197 CCATTTTCCCACACAAAAGTTGG + Intergenic
1194594487 X:95840176-95840198 CCATTATACAACAGAAAAGGGGG - Intergenic
1195774189 X:108384996-108385018 CCCATCCCCCACAGATAAGGCGG - Intronic
1196512809 X:116532299-116532321 CCAAGGCTCCACAGAGAAGGAGG + Intergenic
1196778819 X:119363685-119363707 CATCTGCCCCACAGAAAGGGTGG + Intergenic
1197854674 X:130902574-130902596 CCCATGCCCCAAAGAAAATGGGG + Intronic
1198057498 X:133009415-133009437 CCAATGCCCCACAGATACTGAGG + Intergenic
1199712167 X:150477160-150477182 CGCTTGCCCCGCGGAAAAGGTGG - Intronic
1200432385 Y:3100874-3100896 CCTATGCCCCACAGATAAGCAGG - Intergenic