ID: 947478446

View in Genome Browser
Species Human (GRCh38)
Location 2:230473548-230473570
Sequence CTGGATCACCAACAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947478446 Original CRISPR CTGGATCACCAACAGGAAGT GGG Intronic
901089637 1:6632745-6632767 CTGCATCACCAGCAGGAAGGCGG - Intronic
903780840 1:25819270-25819292 CTGGAGCACAAAGAGGGAGTGGG + Intronic
904035963 1:27558652-27558674 CTGGGCCACCCCCAGGAAGTGGG - Intronic
906355054 1:45098188-45098210 CTGGAAAGCCAACAGGAAGCGGG + Intronic
906731606 1:48086340-48086362 TGGGAGCACCTACAGGAAGTGGG + Intergenic
907425044 1:54374239-54374261 CTGGATCCCCAACACGCCGTGGG - Intronic
907603105 1:55789631-55789653 CTGAATCACCAAAAGCAAGTTGG - Intergenic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
910157776 1:84239818-84239840 CTGGAATACAAGCAGGAAGTAGG + Intergenic
910283932 1:85532069-85532091 CTGGATCAACGGGAGGAAGTTGG - Intronic
912606307 1:110992991-110993013 CTGGATCACCCAGAGGTAATGGG + Intergenic
914206086 1:145530916-145530938 CTGGATCAACGGGAGGAAGTTGG + Intergenic
918416681 1:184316329-184316351 CTGGATCACCAAGAGGTACAAGG - Intergenic
918854780 1:189737655-189737677 CTGGAACACTAACATGAATTTGG + Intergenic
920124886 1:203686294-203686316 CTGTCTCACAAACAGGAACTCGG + Intronic
923039476 1:230309409-230309431 GTGGGTCACCAACAGGCAGCAGG - Intergenic
923863733 1:237917695-237917717 CAGGATCAACAACAGGCTGTGGG - Intergenic
924561232 1:245157104-245157126 ATGGACCACAAACAGGCAGTGGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064600202 10:16985504-16985526 CTGGATGCCAGACAGGAAGTCGG + Intronic
1064691968 10:17927567-17927589 CAGATTCACCAGCAGGAAGTGGG + Intergenic
1065145894 10:22767811-22767833 TTGGGTCACCAAAAGGAAGATGG - Intergenic
1071712983 10:88067865-88067887 CTGGAGCACCATCAGGAAGGGGG + Intergenic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1080272287 11:30463370-30463392 GTGGATCCCCAAATGGAAGTTGG - Intronic
1084471913 11:69367267-69367289 GAGGATCATCAACAGGAAGCAGG - Intronic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1089170822 11:116510367-116510389 CTGGGACACCAGCAGGCAGTAGG - Intergenic
1090223540 11:125053296-125053318 CTGTATGACACACAGGAAGTGGG + Intergenic
1092252961 12:6911420-6911442 CTAGATCATTAACAGGAAGATGG - Intronic
1095852981 12:46831102-46831124 CTGGATCACAAAGAGGAGCTGGG + Intronic
1095891287 12:47236561-47236583 CTGGGTCACTCCCAGGAAGTGGG - Exonic
1097090205 12:56498790-56498812 CAGGATCAACAACAGGCTGTGGG + Intergenic
1098910134 12:76200540-76200562 CTGGATCACCAGCTAGAAGCTGG + Intergenic
1101147492 12:101854901-101854923 TTGGGTCACCATGAGGAAGTGGG - Intergenic
1102422765 12:112817140-112817162 CTGGATCTTCAAATGGAAGTTGG + Intronic
1110058833 13:71015270-71015292 CTGCATCTCGAACAGGAACTGGG - Intergenic
1116173879 14:41440092-41440114 CTGAAGCATCAACAGTAAGTTGG + Intergenic
1117571343 14:57052100-57052122 CTGGAGAACCAACCAGAAGTAGG - Intergenic
1119187789 14:72655795-72655817 CTAACTCACCACCAGGAAGTGGG - Intronic
1121134572 14:91484638-91484660 CTGGATCAAAAACTGCAAGTAGG - Intronic
1121663961 14:95658005-95658027 GGGGATCCCCAACAAGAAGTTGG - Intergenic
1122297657 14:100714343-100714365 CTGGGCCACCGACAGGACGTGGG - Intergenic
1122937746 14:104967745-104967767 CAGGAACACAAACAGGAAGGGGG + Intronic
1124588068 15:31028349-31028371 CAGGTTCACCAGCAGGATGTTGG + Exonic
1124659922 15:31538880-31538902 CTGTAACACCAACATGAATTTGG + Intronic
1125628233 15:41126659-41126681 CTGGCTCTCCAACTGGAAGCTGG + Intergenic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128773191 15:70298687-70298709 CTTGATCTCCAACAGGCTGTTGG - Intergenic
1132076280 15:98823773-98823795 CTGGATCACAAACAGAAAATGGG - Intronic
1132967683 16:2668046-2668068 CAGGATCAACAACAGGCTGTGGG + Intergenic
1135841324 16:25879325-25879347 CTGTATCACCAACATGAAAACGG - Intronic
1136518171 16:30780305-30780327 CTGGATCCCCACCAGGGAGGAGG + Exonic
1137828736 16:51523870-51523892 CTGGATCAGGAGCAGGAAGATGG + Intergenic
1144154801 17:12488954-12488976 ATGGATCACCTACAGGAGGAAGG + Intergenic
1145775844 17:27527955-27527977 CTGGATGACCCACAAGAGGTAGG - Intronic
1147304727 17:39555416-39555438 CTGGACCACCAAGAGCAAGTGGG - Intronic
1147718059 17:42521385-42521407 CTGGCTCACCACCAGGAGGTGGG - Exonic
1148745326 17:49914787-49914809 CTGTAGCATCAACAAGAAGTGGG - Intergenic
1157288562 18:46393932-46393954 CAGGATCCCCACCAGGCAGTGGG - Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1159001983 18:62982543-62982565 CTGGATTTCCAGCAGGAAGCAGG - Intergenic
1164084373 19:21888028-21888050 CAGGATCAACAACAGGCTGTGGG + Intergenic
925357862 2:3254898-3254920 CTGTATCACAAACAGGAAACTGG - Intronic
925433102 2:3814138-3814160 CTGGAGTACCAAAAGGAGGTGGG - Intronic
927258496 2:21061890-21061912 CTGGAGAAACAATAGGAAGTGGG - Intergenic
927527430 2:23758482-23758504 CTGGATTTCCACCAGGAAGGTGG + Intronic
928421016 2:31137993-31138015 CTGGGTAACCAAGAGGAAGTTGG - Exonic
928703396 2:33922109-33922131 CAGGATAACCTAAAGGAAGTAGG - Intergenic
932493476 2:72135351-72135373 CTGGATCACCAGCTGGATCTTGG + Exonic
935894659 2:107721694-107721716 TTGGATGACCAAGAGGCAGTTGG - Intergenic
943336877 2:186626176-186626198 CTGGATCACCAAAAAGGGGTGGG - Intronic
944656356 2:201880154-201880176 CTCGCTCACCATCAGGAAGCTGG - Exonic
947083049 2:226420121-226420143 CTTGATCACCAAGAGGAAGTAGG - Intergenic
947478446 2:230473548-230473570 CTGGATCACCAACAGGAAGTGGG + Intronic
1169216859 20:3799235-3799257 TTGGTTCACAAACAGGAAATGGG + Intronic
1170052305 20:12159213-12159235 CTGGATCAACCACAGGGAGGAGG + Intergenic
1171309245 20:24133023-24133045 CTGGAACACCTAATGGAAGTTGG + Intergenic
1172179324 20:32991244-32991266 CTGGATCCCCAGCACGCAGTAGG + Intronic
1172390018 20:34559765-34559787 CTGGTTCACCAGCAGGAAGAAGG - Exonic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1175418213 20:58815679-58815701 ACAGACCACCAACAGGAAGTGGG - Intergenic
1175949105 20:62573120-62573142 CGGCAACACCAACAGGAAGCGGG + Intergenic
1176110249 20:63407686-63407708 CTGGACCACTCCCAGGAAGTCGG + Intronic
1179169555 21:38962414-38962436 CAGGATGCCCAGCAGGAAGTGGG - Intergenic
1179567625 21:42259012-42259034 TTGGATCACCACCAGGAACAAGG - Intronic
1182535877 22:31002603-31002625 CTGGATAACTAACTGGAGGTAGG + Intergenic
1183365574 22:37404969-37404991 CTTGATCACCAGCAGGTAGCTGG - Intronic
1184751520 22:46489062-46489084 CTGGGTGACCAGCAGGAAGGTGG - Intronic
1185286431 22:50001925-50001947 CTGTCTCACCAACAGCATGTGGG - Intronic
955000001 3:54918779-54918801 CTGGATCAGGAGCAGGAAGAGGG + Exonic
955689577 3:61578131-61578153 ATGTAGCACCAACAGGAACTAGG - Intronic
956685716 3:71825549-71825571 CTCAATCATGAACAGGAAGTGGG + Intergenic
956980268 3:74628562-74628584 GTGGATCCCCAACAGAAAATAGG + Intergenic
957876606 3:86155011-86155033 CTGGATCCTCAGCAGGGAGTAGG - Intergenic
961003265 3:123388306-123388328 CTGTATGACCAACTGAAAGTGGG + Intronic
962725894 3:138226444-138226466 CTGGATCATAAACTGGAGGTGGG - Intronic
966550050 3:181194817-181194839 CTGACTGACCAACTGGAAGTTGG + Intergenic
966778161 3:183561086-183561108 CTGAATCCCAAACAGGAAGTTGG + Intergenic
969725646 4:8916644-8916666 CTGGATCACCTCCAGGCGGTTGG - Intergenic
969912980 4:10461976-10461998 CGGGGTCAGCAACAGGAATTCGG + Intergenic
975318060 4:72978085-72978107 CTGGAACACCACCAGGAAAGAGG + Intergenic
978495517 4:109355615-109355637 TTGGATCTCCAACTGGAACTTGG - Intergenic
979234793 4:118387655-118387677 ATGGTTCACCAAAAAGAAGTTGG - Intergenic
983677151 4:170309068-170309090 ATGGATCCCCAACAGTCAGTCGG - Intergenic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
987137586 5:14914138-14914160 CTGCCTCACCAGCAGGAAATAGG - Intergenic
987864853 5:23525601-23525623 CTGGTTCTCCATCAGGAAGTGGG - Intronic
988863045 5:35304594-35304616 CTGGATCACATACAGAAAGCTGG - Intergenic
994747254 5:103693634-103693656 CTCTATCACCACCAGGAAGGAGG - Intergenic
997490812 5:134274351-134274373 CTTGATCAGCAGGAGGAAGTAGG - Intergenic
999865846 5:155699658-155699680 CCTGATCACCAAGAAGAAGTTGG + Intergenic
1000997375 5:167973335-167973357 TGGGATTACCAACAGGAGGTGGG - Intronic
1002097047 5:176837541-176837563 CAGGGTCACCATCAGGAAATAGG + Intronic
1003831169 6:10013371-10013393 CTTGATAACCAACAGGACGCAGG + Intronic
1010190998 6:73196385-73196407 CAGAAACACCACCAGGAAGTTGG + Exonic
1014112535 6:117635535-117635557 CTGGATAATCAACAGTCAGTAGG + Intergenic
1015403035 6:132808393-132808415 CTGGATCTGCAAAATGAAGTAGG - Intergenic
1016505337 6:144772818-144772840 CTGGACCAACCAGAGGAAGTAGG - Intronic
1020264170 7:6549333-6549355 CTGAGTCACCTGCAGGAAGTAGG - Intronic
1021028866 7:15704039-15704061 CTGGACTACCAAAAGGAAATTGG + Intergenic
1021585654 7:22204769-22204791 ATGGAACAGTAACAGGAAGTTGG + Intronic
1024396813 7:48879006-48879028 CTGGGTGAGTAACAGGAAGTAGG - Intergenic
1033424982 7:141236029-141236051 CTGGATCACCAGCAAGAGATGGG + Intronic
1035380557 7:158437846-158437868 CTGGATCCCAAAGAGAAAGTAGG - Intronic
1038287685 8:26220199-26220221 CTTGATCACCAACATCAAATGGG + Intergenic
1043682852 8:83052552-83052574 CAGGGAGACCAACAGGAAGTAGG - Intergenic
1047823440 8:128547608-128547630 CTGGTTCACCAACAGCAAGGAGG - Intergenic
1049569023 8:143359789-143359811 CTGGGTCACCCACAGGAAGAGGG + Intronic
1056824229 9:89865592-89865614 CTGAGCCACCATCAGGAAGTGGG - Intergenic
1057522332 9:95769846-95769868 TTGGATCACCTACAGGAATCTGG - Intergenic
1059501365 9:114756841-114756863 GTGGACCACCAACTGGAAGAAGG + Intergenic
1060211209 9:121711674-121711696 CTGGCTCAGCAACAGGTAGTGGG + Intronic
1191778264 X:64842488-64842510 TTGGATCTCTAACAGTAAGTGGG - Intergenic
1192065099 X:67875535-67875557 CTGGAAAACCTAGAGGAAGTGGG - Intergenic
1192336019 X:70220449-70220471 CTGGCTCACCTCCAGGCAGTTGG - Intergenic
1194359247 X:92928314-92928336 CCGGCTCACCAACAAGAAATGGG + Intergenic
1197883442 X:131193126-131193148 CTGGATCACAAAGAGGAACTGGG - Intergenic