ID: 947485059

View in Genome Browser
Species Human (GRCh38)
Location 2:230540398-230540420
Sequence TTCTAGGTATAAGATATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947485056_947485059 5 Left 947485056 2:230540370-230540392 CCTTTTCAAGAAGTTTCTGCAGC 0: 1
1: 0
2: 3
3: 21
4: 224
Right 947485059 2:230540398-230540420 TTCTAGGTATAAGATATGGCAGG 0: 1
1: 0
2: 2
3: 9
4: 103
947485055_947485059 20 Left 947485055 2:230540355-230540377 CCTCTCTGGAGATTTCCTTTTCA 0: 1
1: 0
2: 6
3: 105
4: 1449
Right 947485059 2:230540398-230540420 TTCTAGGTATAAGATATGGCAGG 0: 1
1: 0
2: 2
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947485059 Original CRISPR TTCTAGGTATAAGATATGGC AGG Intronic
905254422 1:36670952-36670974 TTCTAGGTATAGGATATGGTAGG + Intergenic
917066463 1:171100083-171100105 CACTGTGTATAAGATATGGCTGG - Intronic
917628266 1:176867639-176867661 TTTTATGTGTAAGATCTGGCAGG - Intronic
918550500 1:185736113-185736135 TGGTAGGTATTAAATATGGCAGG + Intronic
922115670 1:222611251-222611273 TGGTAGGTATAAAATATGGTAGG - Intergenic
923989201 1:239415879-239415901 TTGTTGGTATAAAATATGACAGG + Intronic
1064032236 10:11890256-11890278 TTCCAGGTCTCAGAGATGGCAGG + Intergenic
1065477928 10:26160873-26160895 TTCAAGCTATAAGATTAGGCTGG - Intronic
1065738356 10:28774219-28774241 TTCTAGAGATAAGAGAGGGCTGG + Intergenic
1066028775 10:31395384-31395406 TCCTAGGTATATGATATGAAAGG + Intronic
1068498173 10:57811829-57811851 TTCTATGTATGAGATTAGGCTGG - Intergenic
1077966899 11:7144458-7144480 TTCAAGGTATAATATTGGGCTGG + Intergenic
1078536088 11:12175623-12175645 TCCTAGGTAGAAGATACAGCAGG + Intronic
1086598230 11:88600489-88600511 TTCTAGGTTTAAATTTTGGCTGG - Intronic
1087875150 11:103346797-103346819 TTCTAGATAATAAATATGGCAGG + Intronic
1089606554 11:119644795-119644817 TTCCAAGTATTGGATATGGCTGG + Intronic
1092846389 12:12589111-12589133 TTCTTGTTATTAGATATGGGGGG - Intergenic
1093122314 12:15286041-15286063 ATCTGGGTATAAAATTTGGCTGG - Intronic
1093660620 12:21752635-21752657 AACTAAATATAAGATATGGCAGG + Intronic
1093880966 12:24404381-24404403 TTCAAGGTATAAATTATGCCAGG - Intergenic
1095538254 12:43277442-43277464 TTCTAGGTATCAACTATGCCTGG - Intergenic
1096719235 12:53508763-53508785 TTCTAGGAAAAGGAAATGGCCGG - Intronic
1099645034 12:85342086-85342108 TTGTAGGTAATAGACATGGCAGG - Intergenic
1101610305 12:106285086-106285108 TTCTAGGTAGCAGGAATGGCAGG - Intronic
1101665792 12:106812848-106812870 TTCTAAATATCAGGTATGGCAGG + Intronic
1105925249 13:25002057-25002079 TTCTAAGTATTAGATGTGGCTGG - Intergenic
1106039397 13:26075300-26075322 TTCTAAGTATTAGATGTGGCTGG + Intergenic
1107118597 13:36774256-36774278 ATCTGGGTATATGATTTGGCAGG - Intergenic
1109672693 13:65630472-65630494 ATCTAGGTGAAAGATATGGTAGG + Intergenic
1111022895 13:82478179-82478201 TTCAGGGTATAAGAAATTGCAGG + Intergenic
1112779390 13:102882516-102882538 TTCTAAGTATAAAAGAGGGCAGG - Intergenic
1114130449 14:19785916-19785938 TTCAAGGAATAAGAGCTGGCCGG + Intronic
1119481012 14:74957788-74957810 TGCTAGGGATATGATATGGAGGG + Intergenic
1127709372 15:61580304-61580326 TTGTAGGTAAAAGATGAGGCCGG + Intergenic
1127942425 15:63712714-63712736 TTCAAGGTATATGATATGTAAGG - Intronic
1134333465 16:13271660-13271682 TTCTAGGTATATGAAATGTCTGG + Intergenic
1136048020 16:27630812-27630834 TAATATGTATAATATATGGCCGG - Intronic
1144956920 17:19023332-19023354 TGCTAGGAACAAGATTTGGCTGG + Intronic
1146232626 17:31127204-31127226 TTCTTAGTATAAAGTATGGCAGG + Intronic
1149071242 17:52546022-52546044 TTCAATGTATGAAATATGGCTGG - Intergenic
1155592459 18:27443257-27443279 TTCTAGGTATAAGCTGGGCCCGG + Intergenic
1156695280 18:39758899-39758921 TTCTATGTTTAAGATATGTAGGG - Intergenic
1158112296 18:53953894-53953916 TTCTAGGTATATGATATCATTGG - Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
927349477 2:22091961-22091983 TTCTAGGTATAAAATATCATCGG + Intergenic
929825626 2:45307392-45307414 TTCTATGGGTAAGATTTGGCAGG + Intergenic
929934350 2:46283695-46283717 TTCTAGATATAAGATCCAGCAGG - Intergenic
935529983 2:104220577-104220599 TTCCATGCATCAGATATGGCTGG + Intergenic
939727825 2:145745433-145745455 TTCTAGGTATTAGAGATCTCAGG - Intergenic
940822508 2:158372649-158372671 TTCTACATATAGGATATGGAAGG - Intronic
941447919 2:165625216-165625238 TTCTAGGTATTGGATATGGCAGG + Intronic
942458481 2:176153154-176153176 CTCTAAGTATATTATATGGCAGG + Exonic
947485059 2:230540398-230540420 TTCTAGGTATAAGATATGGCAGG + Intronic
1172624872 20:36341186-36341208 TTCTGGGCAGAAGAGATGGCCGG - Intronic
1173083900 20:39896675-39896697 TTCTAGGTATAATACATGTTTGG - Intergenic
1173425065 20:42935438-42935460 TTCTAAAGATAAGTTATGGCAGG - Intronic
1174795405 20:53518205-53518227 ATATATGTATAAAATATGGCTGG + Intergenic
1175506919 20:59492529-59492551 TTCAAGGTAGAAGATGTGCCAGG - Intergenic
1177625249 21:23651151-23651173 TTCTATGTAAAAGATGTGGCCGG + Intergenic
1180061876 21:45389688-45389710 TTCTAGTTAGAAAATGTGGCCGG - Intergenic
1182175947 22:28289068-28289090 GTCTAGGTAAAAGAGATGGGAGG + Intronic
1182927327 22:34137681-34137703 TTCTATGTATACGATATGATAGG - Intergenic
1184269862 22:43373690-43373712 TTCCAGGAAGAAGAAATGGCAGG - Intergenic
952506280 3:34009384-34009406 TTCTAGGTATAAGGAATGCAGGG + Intergenic
953373578 3:42409979-42410001 TTCCAGGTAGAAGGAATGGCTGG - Intronic
956963172 3:74427154-74427176 TTCTGGATATCTGATATGGCCGG + Intronic
957504768 3:81105575-81105597 ATCTAGTTATAAGTTATGACTGG + Intergenic
958094306 3:88922590-88922612 TTCTAAGTATATCATATGGCAGG - Intergenic
962920898 3:139949544-139949566 TTTTGGGTATAAGTTATGGCTGG + Intronic
964332049 3:155613872-155613894 TTCTAGGGATAAAATATCGTTGG - Intronic
965761965 3:172088058-172088080 TTCCAGGAACAAGATGTGGCAGG - Intronic
966996242 3:185283263-185283285 TTCTAGGAATCAGACATGGCTGG + Intronic
970338511 4:15079834-15079856 TTCTATGTCAAATATATGGCAGG - Intergenic
970884689 4:20974471-20974493 TTCTAGGAATAATATAAGCCAGG + Intronic
970894926 4:21091261-21091283 TTCTAGGATTAAAATATGGCAGG + Intronic
971559259 4:28055125-28055147 TTTTAGGTATAAGATAATACAGG + Intergenic
971636358 4:29064106-29064128 TTCTTGGTAAAAGATAGTGCAGG + Intergenic
973042384 4:45486704-45486726 TTATAGGTAGAAGAAATGTCAGG - Intergenic
975812528 4:78183665-78183687 TTCTGGGCATGAGGTATGGCAGG + Intronic
977201712 4:94123995-94124017 TCTTAGGTTTAAGATTTGGCCGG - Intergenic
977993480 4:103473988-103474010 TTCAAAGTATAAAATAAGGCTGG + Intergenic
980818235 4:137977050-137977072 TTGTAGGTATTGAATATGGCAGG - Intergenic
982795077 4:159634680-159634702 TGTTAGGAAGAAGATATGGCTGG + Intergenic
986403882 5:7406383-7406405 TCCTAGGTATATGAGGTGGCTGG - Intronic
987417636 5:17680736-17680758 TTCTAGGTGTAAGAGAAGACAGG - Intergenic
987650610 5:20735325-20735347 TTCTAAGTATGAGATATTGTAGG + Intergenic
988112489 5:26840340-26840362 TTATAGGCAGAATATATGGCTGG + Intergenic
988527655 5:32000822-32000844 TTATAGGTATATGTTAGGGCAGG + Intronic
989774776 5:45191569-45191591 TTCTAGCTTTAAGATTGGGCTGG - Intergenic
995659413 5:114464168-114464190 TTTTAGGTATAGGAAATGGGAGG + Intronic
996134096 5:119817666-119817688 TCCTAGAGATAAGATCTGGCTGG - Intergenic
998209986 5:140188396-140188418 TTCTAGCTATTAAAAATGGCAGG + Intronic
1006993427 6:38235547-38235569 TTCAAGGTTTAAGATAGGGAGGG + Intronic
1006998380 6:38284644-38284666 TTTTATGTATCAGGTATGGCTGG + Intronic
1009823516 6:68836674-68836696 TTCTAAGTAAGATATATGGCAGG - Intronic
1010852745 6:80797940-80797962 TTCCAGGTATAAAATATTGCAGG + Intergenic
1011964184 6:93132832-93132854 TTCTAGATATAACATCTGGTAGG - Intergenic
1013444333 6:110206779-110206801 TTCTTGGTAATAGATATTGCAGG - Intronic
1014398513 6:120957086-120957108 TTCTAGAAATAAGATGTTGCTGG - Intergenic
1016843911 6:148552386-148552408 TTCTCAGTAGAAGATATGGGTGG - Intergenic
1020988244 7:15163056-15163078 TTCTAGGTATTTGATTTTGCGGG + Intergenic
1021735111 7:23635336-23635358 TTCAAGGTCTAAGATAGGGAAGG + Intronic
1022840196 7:34157098-34157120 TTGTAGGTGTGAGATGTGGCTGG + Intergenic
1028529895 7:91827026-91827048 TTCTAGGCAGAGGAAATGGCAGG - Intronic
1028783949 7:94770829-94770851 TTCTAGGTATACGATTTTGTTGG - Intergenic
1032771222 7:135059051-135059073 TTCTAATTATAAGAAGTGGCCGG - Intronic
1036567435 8:9949501-9949523 TTGTAGTTAAAAGACATGGCGGG - Intergenic
1047960382 8:130007486-130007508 TTCAAAGTATATGACATGGCTGG + Intronic
1051177288 9:14373746-14373768 TTGTTGGAATAAGATTTGGCAGG + Intronic
1058746299 9:107994487-107994509 TTCTAGGTATCAGACAAAGCTGG - Intergenic
1191580731 X:62758017-62758039 TTGTTGGTGTAAGCTATGGCAGG - Intergenic
1194435232 X:93861088-93861110 TTCTAATGATAAGAGATGGCAGG - Intergenic
1197512823 X:127392100-127392122 TTCTCAGTATAAAATGTGGCAGG + Intergenic
1198642747 X:138774758-138774780 TTCTGGGTATATGATAGGTCAGG - Intronic
1202020139 Y:20455969-20455991 TTCTAGGTCTAAGAAAGGCCAGG + Intergenic