ID: 947488753

View in Genome Browser
Species Human (GRCh38)
Location 2:230575905-230575927
Sequence TAATCGGTAAGGCTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947488753_947488761 -9 Left 947488753 2:230575905-230575927 CCCTCCACCAGCCTTACCGATTA No data
Right 947488761 2:230575919-230575941 TACCGATTATTTCAGGGGCTTGG No data
947488753_947488766 26 Left 947488753 2:230575905-230575927 CCCTCCACCAGCCTTACCGATTA No data
Right 947488766 2:230575954-230575976 CTTGCCATCTGGATGTCTTCCGG No data
947488753_947488767 27 Left 947488753 2:230575905-230575927 CCCTCCACCAGCCTTACCGATTA No data
Right 947488767 2:230575955-230575977 TTGCCATCTGGATGTCTTCCGGG No data
947488753_947488763 15 Left 947488753 2:230575905-230575927 CCCTCCACCAGCCTTACCGATTA No data
Right 947488763 2:230575943-230575965 TACACGCCTTCCTTGCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947488753 Original CRISPR TAATCGGTAAGGCTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr