ID: 947492906

View in Genome Browser
Species Human (GRCh38)
Location 2:230611226-230611248
Sequence TTCTCCACACACACCCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947492905_947492906 0 Left 947492905 2:230611203-230611225 CCTTAGAGTGTAGAGGGAAATTC No data
Right 947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG No data
947492903_947492906 6 Left 947492903 2:230611197-230611219 CCAACTCCTTAGAGTGTAGAGGG No data
Right 947492906 2:230611226-230611248 TTCTCCACACACACCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947492906 Original CRISPR TTCTCCACACACACCCTTCA AGG Intergenic
No off target data available for this crispr