ID: 947493017 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:230611999-230612021 |
| Sequence | GGGCACACAGCAGTGATGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 947493012_947493017 | 2 | Left | 947493012 | 2:230611974-230611996 | CCTCCAGAGCAACTCAGACTTCT | No data | ||
| Right | 947493017 | 2:230611999-230612021 | GGGCACACAGCAGTGATGCAGGG | No data | ||||
| 947493013_947493017 | -1 | Left | 947493013 | 2:230611977-230611999 | CCAGAGCAACTCAGACTTCTAAG | No data | ||
| Right | 947493017 | 2:230611999-230612021 | GGGCACACAGCAGTGATGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 947493017 | Original CRISPR | GGGCACACAGCAGTGATGCA GGG | Intergenic | ||
| No off target data available for this crispr | |||||