ID: 947493017

View in Genome Browser
Species Human (GRCh38)
Location 2:230611999-230612021
Sequence GGGCACACAGCAGTGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947493012_947493017 2 Left 947493012 2:230611974-230611996 CCTCCAGAGCAACTCAGACTTCT No data
Right 947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG No data
947493013_947493017 -1 Left 947493013 2:230611977-230611999 CCAGAGCAACTCAGACTTCTAAG No data
Right 947493017 2:230611999-230612021 GGGCACACAGCAGTGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947493017 Original CRISPR GGGCACACAGCAGTGATGCA GGG Intergenic
No off target data available for this crispr