ID: 947493761

View in Genome Browser
Species Human (GRCh38)
Location 2:230618009-230618031
Sequence GTTACTTCTCTGGTCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947493761_947493763 -2 Left 947493761 2:230618009-230618031 CCAGGTGGGACCAGAGAAGTAAC No data
Right 947493763 2:230618030-230618052 ACTATTCCAAAGCCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947493761 Original CRISPR GTTACTTCTCTGGTCCCACC TGG (reversed) Intergenic