ID: 947493763

View in Genome Browser
Species Human (GRCh38)
Location 2:230618030-230618052
Sequence ACTATTCCAAAGCCCTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947493761_947493763 -2 Left 947493761 2:230618009-230618031 CCAGGTGGGACCAGAGAAGTAAC No data
Right 947493763 2:230618030-230618052 ACTATTCCAAAGCCCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947493763 Original CRISPR ACTATTCCAAAGCCCTGCTC AGG Intergenic
No off target data available for this crispr