ID: 947495400

View in Genome Browser
Species Human (GRCh38)
Location 2:230632441-230632463
Sequence GGTTCTAGATGCTTACCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947495400_947495411 0 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495411 2:230632464-230632486 CACCTGTGGCGGTGGGGGGCGGG 0: 1
1: 0
2: 1
3: 44
4: 424
947495400_947495412 1 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495412 2:230632465-230632487 ACCTGTGGCGGTGGGGGGCGGGG 0: 1
1: 1
2: 4
3: 56
4: 523
947495400_947495410 -1 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495410 2:230632463-230632485 CCACCTGTGGCGGTGGGGGGCGG 0: 1
1: 0
2: 3
3: 43
4: 496
947495400_947495403 -8 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495403 2:230632456-230632478 CTAGAACCCACCTGTGGCGGTGG 0: 1
1: 0
2: 0
3: 4
4: 64
947495400_947495416 9 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495416 2:230632473-230632495 CGGTGGGGGGCGGGGGGTGCAGG 0: 1
1: 3
2: 42
3: 366
4: 2463
947495400_947495415 3 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495415 2:230632467-230632489 CTGTGGCGGTGGGGGGCGGGGGG 0: 1
1: 1
2: 19
3: 219
4: 1728
947495400_947495414 2 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495414 2:230632466-230632488 CCTGTGGCGGTGGGGGGCGGGGG 0: 1
1: 0
2: 13
3: 135
4: 1071
947495400_947495405 -6 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495405 2:230632458-230632480 AGAACCCACCTGTGGCGGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 133
947495400_947495407 -4 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495407 2:230632460-230632482 AACCCACCTGTGGCGGTGGGGGG 0: 1
1: 1
2: 1
3: 11
4: 138
947495400_947495406 -5 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495406 2:230632459-230632481 GAACCCACCTGTGGCGGTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 142
947495400_947495404 -7 Left 947495400 2:230632441-230632463 CCTCTGGGTAAGCATCTAGAACC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 947495404 2:230632457-230632479 TAGAACCCACCTGTGGCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947495400 Original CRISPR GGTTCTAGATGCTTACCCAG AGG (reversed) Intergenic