ID: 947496047

View in Genome Browser
Species Human (GRCh38)
Location 2:230637977-230637999
Sequence TCACCTAGGCAGGAGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496047_947496057 15 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496057 2:230638015-230638037 GTCCCAAAAAAAGGAGAGGGAGG No data
947496047_947496052 6 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496052 2:230638006-230638028 GGAGACCCTGTCCCAAAAAAAGG No data
947496047_947496066 27 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data
947496047_947496064 25 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496064 2:230638025-230638047 AAGGAGAGGGAGGGAAGGGGAGG No data
947496047_947496054 11 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496054 2:230638011-230638033 CCCTGTCCCAAAAAAAGGAGAGG No data
947496047_947496063 22 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496063 2:230638022-230638044 AAAAAGGAGAGGGAGGGAAGGGG No data
947496047_947496056 12 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496056 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
947496047_947496067 30 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496067 2:230638030-230638052 GAGGGAGGGAAGGGGAGGGGAGG No data
947496047_947496061 20 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496061 2:230638020-230638042 AAAAAAAGGAGAGGGAGGGAAGG No data
947496047_947496062 21 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496062 2:230638021-230638043 AAAAAAGGAGAGGGAGGGAAGGG No data
947496047_947496058 16 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496058 2:230638016-230638038 TCCCAAAAAAAGGAGAGGGAGGG No data
947496047_947496065 26 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496065 2:230638026-230638048 AGGAGAGGGAGGGAAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496047 Original CRISPR TCACCTAGGCAGGAGTGCAG TGG (reversed) Intergenic