ID: 947496051

View in Genome Browser
Species Human (GRCh38)
Location 2:230637991-230638013
Sequence GGGTCTCCCTGTCATCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496051_947496071 22 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496071 2:230638036-230638058 GGGAAGGGGAGGGGAGGGGAGGG No data
947496051_947496054 -3 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496054 2:230638011-230638033 CCCTGTCCCAAAAAAAGGAGAGG No data
947496051_947496063 8 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496063 2:230638022-230638044 AAAAAGGAGAGGGAGGGAAGGGG No data
947496051_947496070 21 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496070 2:230638035-230638057 AGGGAAGGGGAGGGGAGGGGAGG No data
947496051_947496072 26 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data
947496051_947496069 18 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496069 2:230638032-230638054 GGGAGGGAAGGGGAGGGGAGGGG No data
947496051_947496058 2 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496058 2:230638016-230638038 TCCCAAAAAAAGGAGAGGGAGGG No data
947496051_947496056 -2 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496056 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
947496051_947496062 7 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496062 2:230638021-230638043 AAAAAAGGAGAGGGAGGGAAGGG No data
947496051_947496067 16 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496067 2:230638030-230638052 GAGGGAGGGAAGGGGAGGGGAGG No data
947496051_947496061 6 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496061 2:230638020-230638042 AAAAAAAGGAGAGGGAGGGAAGG No data
947496051_947496052 -8 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496052 2:230638006-230638028 GGAGACCCTGTCCCAAAAAAAGG No data
947496051_947496065 12 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496065 2:230638026-230638048 AGGAGAGGGAGGGAAGGGGAGGG No data
947496051_947496066 13 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data
947496051_947496064 11 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496064 2:230638025-230638047 AAGGAGAGGGAGGGAAGGGGAGG No data
947496051_947496057 1 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496057 2:230638015-230638037 GTCCCAAAAAAAGGAGAGGGAGG No data
947496051_947496068 17 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496068 2:230638031-230638053 AGGGAGGGAAGGGGAGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496051 Original CRISPR GGGTCTCCCTGTCATCACCT AGG (reversed) Intergenic