ID: 947496052

View in Genome Browser
Species Human (GRCh38)
Location 2:230638006-230638028
Sequence GGAGACCCTGTCCCAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496050_947496052 -4 Left 947496050 2:230637987-230638009 CCTGCCTAGGTGATGACAGGGAG No data
Right 947496052 2:230638006-230638028 GGAGACCCTGTCCCAAAAAAAGG No data
947496051_947496052 -8 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496052 2:230638006-230638028 GGAGACCCTGTCCCAAAAAAAGG No data
947496047_947496052 6 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496052 2:230638006-230638028 GGAGACCCTGTCCCAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496052 Original CRISPR GGAGACCCTGTCCCAAAAAA AGG Intergenic