ID: 947496055

View in Genome Browser
Species Human (GRCh38)
Location 2:230638012-230638034
Sequence CCCTCTCCTTTTTTTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496055_947496067 -5 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496067 2:230638030-230638052 GAGGGAGGGAAGGGGAGGGGAGG 0: 13
1: 159
2: 1006
3: 5349
4: 14419
947496055_947496065 -9 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496065 2:230638026-230638048 AGGAGAGGGAGGGAAGGGGAGGG No data
947496055_947496068 -4 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496068 2:230638031-230638053 AGGGAGGGAAGGGGAGGGGAGGG 0: 30
1: 579
2: 3628
3: 7816
4: 21760
947496055_947496064 -10 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496064 2:230638025-230638047 AAGGAGAGGGAGGGAAGGGGAGG No data
947496055_947496071 1 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496071 2:230638036-230638058 GGGAAGGGGAGGGGAGGGGAGGG 0: 309
1: 2586
2: 4892
3: 10160
4: 16996
947496055_947496066 -8 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG 0: 2
1: 59
2: 533
3: 3293
4: 14982
947496055_947496070 0 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496070 2:230638035-230638057 AGGGAAGGGGAGGGGAGGGGAGG 0: 274
1: 2353
2: 4146
3: 8825
4: 14150
947496055_947496069 -3 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496069 2:230638032-230638054 GGGAGGGAAGGGGAGGGGAGGGG 0: 98
1: 2170
2: 4156
3: 7624
4: 14690
947496055_947496072 5 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG 0: 266
1: 2415
2: 4213
3: 8961
4: 16047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496055 Original CRISPR CCCTCTCCTTTTTTTGGGAC AGG (reversed) Intergenic
No off target data available for this crispr