ID: 947496059

View in Genome Browser
Species Human (GRCh38)
Location 2:230638017-230638039
Sequence TCCCTCCCTCTCCTTTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496059_947496070 -5 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496070 2:230638035-230638057 AGGGAAGGGGAGGGGAGGGGAGG No data
947496059_947496068 -9 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496068 2:230638031-230638053 AGGGAGGGAAGGGGAGGGGAGGG No data
947496059_947496069 -8 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496069 2:230638032-230638054 GGGAGGGAAGGGGAGGGGAGGGG No data
947496059_947496071 -4 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496071 2:230638036-230638058 GGGAAGGGGAGGGGAGGGGAGGG No data
947496059_947496067 -10 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496067 2:230638030-230638052 GAGGGAGGGAAGGGGAGGGGAGG No data
947496059_947496072 0 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496059 Original CRISPR TCCCTCCCTCTCCTTTTTTT GGG (reversed) Intergenic