ID: 947496061

View in Genome Browser
Species Human (GRCh38)
Location 2:230638020-230638042
Sequence AAAAAAAGGAGAGGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496051_947496061 6 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496061 2:230638020-230638042 AAAAAAAGGAGAGGGAGGGAAGG No data
947496047_947496061 20 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496061 2:230638020-230638042 AAAAAAAGGAGAGGGAGGGAAGG No data
947496050_947496061 10 Left 947496050 2:230637987-230638009 CCTGCCTAGGTGATGACAGGGAG No data
Right 947496061 2:230638020-230638042 AAAAAAAGGAGAGGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496061 Original CRISPR AAAAAAAGGAGAGGGAGGGA AGG Intergenic