ID: 947496062

View in Genome Browser
Species Human (GRCh38)
Location 2:230638021-230638043
Sequence AAAAAAGGAGAGGGAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496047_947496062 21 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496062 2:230638021-230638043 AAAAAAGGAGAGGGAGGGAAGGG No data
947496051_947496062 7 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496062 2:230638021-230638043 AAAAAAGGAGAGGGAGGGAAGGG No data
947496050_947496062 11 Left 947496050 2:230637987-230638009 CCTGCCTAGGTGATGACAGGGAG No data
Right 947496062 2:230638021-230638043 AAAAAAGGAGAGGGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496062 Original CRISPR AAAAAAGGAGAGGGAGGGAA GGG Intergenic