ID: 947496066

View in Genome Browser
Species Human (GRCh38)
Location 2:230638027-230638049
Sequence GGAGAGGGAGGGAAGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496055_947496066 -8 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data
947496051_947496066 13 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data
947496047_947496066 27 Left 947496047 2:230637977-230637999 CCACTGCACTCCTGCCTAGGTGA No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data
947496053_947496066 -7 Left 947496053 2:230638011-230638033 CCCTGTCCCAAAAAAAGGAGAGG No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data
947496050_947496066 17 Left 947496050 2:230637987-230638009 CCTGCCTAGGTGATGACAGGGAG No data
Right 947496066 2:230638027-230638049 GGAGAGGGAGGGAAGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496066 Original CRISPR GGAGAGGGAGGGAAGGGGAG GGG Intergenic