ID: 947496072

View in Genome Browser
Species Human (GRCh38)
Location 2:230638040-230638062
Sequence AGGGGAGGGGAGGGGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496053_947496072 6 Left 947496053 2:230638011-230638033 CCCTGTCCCAAAAAAAGGAGAGG No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data
947496050_947496072 30 Left 947496050 2:230637987-230638009 CCTGCCTAGGTGATGACAGGGAG No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data
947496059_947496072 0 Left 947496059 2:230638017-230638039 CCCAAAAAAAGGAGAGGGAGGGA No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data
947496055_947496072 5 Left 947496055 2:230638012-230638034 CCTGTCCCAAAAAAAGGAGAGGG No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data
947496060_947496072 -1 Left 947496060 2:230638018-230638040 CCAAAAAAAGGAGAGGGAGGGAA No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data
947496051_947496072 26 Left 947496051 2:230637991-230638013 CCTAGGTGATGACAGGGAGACCC No data
Right 947496072 2:230638040-230638062 AGGGGAGGGGAGGGGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496072 Original CRISPR AGGGGAGGGGAGGGGAGGGA AGG Intergenic