ID: 947496686

View in Genome Browser
Species Human (GRCh38)
Location 2:230642940-230642962
Sequence TCACCCTGCTTGGCAAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947496684_947496686 -10 Left 947496684 2:230642927-230642949 CCATGGCTGGAACTCACCCTGCT No data
Right 947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG No data
947496683_947496686 -2 Left 947496683 2:230642919-230642941 CCTGGAGGCCATGGCTGGAACTC No data
Right 947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG No data
947496679_947496686 13 Left 947496679 2:230642904-230642926 CCAAAGAATCTATAGCCTGGAGG No data
Right 947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG No data
947496678_947496686 14 Left 947496678 2:230642903-230642925 CCCAAAGAATCTATAGCCTGGAG No data
Right 947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG No data
947496676_947496686 19 Left 947496676 2:230642898-230642920 CCACACCCAAAGAATCTATAGCC No data
Right 947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947496686 Original CRISPR TCACCCTGCTTGGCAAATAC AGG Intergenic
No off target data available for this crispr