ID: 947497349

View in Genome Browser
Species Human (GRCh38)
Location 2:230647562-230647584
Sequence ACAAAGTGATCCACTCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947497349_947497353 22 Left 947497349 2:230647562-230647584 CCAAGGTGAGTGGATCACTTTGT No data
Right 947497353 2:230647607-230647629 ACTCCGTCTTGATTAGGAGCCGG No data
947497349_947497354 23 Left 947497349 2:230647562-230647584 CCAAGGTGAGTGGATCACTTTGT No data
Right 947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG No data
947497349_947497352 16 Left 947497349 2:230647562-230647584 CCAAGGTGAGTGGATCACTTTGT No data
Right 947497352 2:230647601-230647623 AGAGCAACTCCGTCTTGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947497349 Original CRISPR ACAAAGTGATCCACTCACCT TGG (reversed) Intergenic
No off target data available for this crispr