ID: 947497354

View in Genome Browser
Species Human (GRCh38)
Location 2:230647608-230647630
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947497349_947497354 23 Left 947497349 2:230647562-230647584 CCAAGGTGAGTGGATCACTTTGT No data
Right 947497354 2:230647608-230647630 CTCCGTCTTGATTAGGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr