ID: 947502380

View in Genome Browser
Species Human (GRCh38)
Location 2:230680815-230680837
Sequence CTGTTGTCCTCGGGCAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947502380_947502385 -5 Left 947502380 2:230680815-230680837 CCGGCTCTGCCCGAGGACAACAG No data
Right 947502385 2:230680833-230680855 AACAGGCAGGTAAAGCTTCCTGG No data
947502380_947502390 25 Left 947502380 2:230680815-230680837 CCGGCTCTGCCCGAGGACAACAG No data
Right 947502390 2:230680863-230680885 GATACCTGTGCTGGGCACTGAGG No data
947502380_947502389 17 Left 947502380 2:230680815-230680837 CCGGCTCTGCCCGAGGACAACAG No data
Right 947502389 2:230680855-230680877 GCAGAGGTGATACCTGTGCTGGG No data
947502380_947502388 16 Left 947502380 2:230680815-230680837 CCGGCTCTGCCCGAGGACAACAG No data
Right 947502388 2:230680854-230680876 GGCAGAGGTGATACCTGTGCTGG No data
947502380_947502386 1 Left 947502380 2:230680815-230680837 CCGGCTCTGCCCGAGGACAACAG No data
Right 947502386 2:230680839-230680861 CAGGTAAAGCTTCCTGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947502380 Original CRISPR CTGTTGTCCTCGGGCAGAGC CGG (reversed) Intergenic
No off target data available for this crispr