ID: 947502486

View in Genome Browser
Species Human (GRCh38)
Location 2:230681594-230681616
Sequence CTAGGATTACCCAGTGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947502483_947502486 15 Left 947502483 2:230681556-230681578 CCAGGGTACTGTGGTGGGGAATG No data
Right 947502486 2:230681594-230681616 CTAGGATTACCCAGTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947502486 Original CRISPR CTAGGATTACCCAGTGAAGA TGG Intergenic
No off target data available for this crispr