ID: 947505344

View in Genome Browser
Species Human (GRCh38)
Location 2:230704243-230704265
Sequence AGGGAGAGCACAGTGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947505344_947505352 24 Left 947505344 2:230704243-230704265 CCTGCAATCACTGTGCTCTCCCT No data
Right 947505352 2:230704290-230704312 GTGCCCCATGGTTGCTGCCAGGG No data
947505344_947505358 30 Left 947505344 2:230704243-230704265 CCTGCAATCACTGTGCTCTCCCT No data
Right 947505358 2:230704296-230704318 CATGGTTGCTGCCAGGGGATGGG No data
947505344_947505357 29 Left 947505344 2:230704243-230704265 CCTGCAATCACTGTGCTCTCCCT No data
Right 947505357 2:230704295-230704317 CCATGGTTGCTGCCAGGGGATGG No data
947505344_947505350 12 Left 947505344 2:230704243-230704265 CCTGCAATCACTGTGCTCTCCCT No data
Right 947505350 2:230704278-230704300 CAGATTCTCTTCGTGCCCCATGG No data
947505344_947505353 25 Left 947505344 2:230704243-230704265 CCTGCAATCACTGTGCTCTCCCT No data
Right 947505353 2:230704291-230704313 TGCCCCATGGTTGCTGCCAGGGG No data
947505344_947505351 23 Left 947505344 2:230704243-230704265 CCTGCAATCACTGTGCTCTCCCT No data
Right 947505351 2:230704289-230704311 CGTGCCCCATGGTTGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947505344 Original CRISPR AGGGAGAGCACAGTGATTGC AGG (reversed) Intergenic