ID: 947506405

View in Genome Browser
Species Human (GRCh38)
Location 2:230711578-230711600
Sequence CAGAGGGAATAGCAGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947506405_947506412 17 Left 947506405 2:230711578-230711600 CCTTGGTCCTGCTATTCCCTCTG 0: 1
1: 0
2: 4
3: 46
4: 415
Right 947506412 2:230711618-230711640 CTCCCAGGCTCTCTCTCTCCAGG 0: 1
1: 0
2: 6
3: 79
4: 561
947506405_947506410 2 Left 947506405 2:230711578-230711600 CCTTGGTCCTGCTATTCCCTCTG 0: 1
1: 0
2: 4
3: 46
4: 415
Right 947506410 2:230711603-230711625 TTTCCATACAGAAAGCTCCCAGG 0: 1
1: 0
2: 2
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947506405 Original CRISPR CAGAGGGAATAGCAGGACCA AGG (reversed) Intergenic
900337198 1:2170090-2170112 CAGGGTGAAGAGCAGAACCAGGG - Intronic
900474557 1:2869996-2870018 CAGAGGGAAGAGGAGGATGAAGG + Intergenic
900861336 1:5234519-5234541 CAGAGGGAAGAGCGGCACCAGGG - Intergenic
901028220 1:6290473-6290495 CTGAGGGCACAGCAGGGCCATGG - Intronic
902256946 1:15195710-15195732 CTGAGGGAAGAGCTGGCCCAGGG + Intronic
902557802 1:17257259-17257281 CAGGGGAAATGGCAGAACCAGGG - Intronic
902573007 1:17359074-17359096 CAGAGGGAATGGGAGGCCCCAGG + Intronic
902722757 1:18315034-18315056 CAGAGGGGAGAGCAGGGACAAGG + Intronic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
903370515 1:22832152-22832174 CAGCAGGAATAGCAGGAACAGGG + Intronic
903714700 1:25356277-25356299 AAGAGGGAAGAGCAGGGACAGGG - Intronic
903849263 1:26296482-26296504 CAGAGGGAACAGCAACAGCACGG + Intronic
904261193 1:29288750-29288772 CAGAGGAAGTTCCAGGACCAGGG + Intronic
904480239 1:30788771-30788793 CAGAGGGAACAGCATGTACAAGG + Intergenic
904598569 1:31661677-31661699 CAGGGGGGCCAGCAGGACCAGGG + Exonic
904869198 1:33606012-33606034 CAGAGGGAGTAGCTGGGCTAAGG + Intronic
905013786 1:34763479-34763501 CAGAGGAAATAGCATGACAAAGG - Exonic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
907456791 1:54581423-54581445 CAGAGGGAAAAGCTGGCCCAGGG - Intronic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907849111 1:58236972-58236994 AAGAGGGAGTATAAGGACCAAGG - Intronic
907927914 1:58972053-58972075 CAGAGGGAACAGCATCACCAGGG - Intergenic
907970442 1:59375717-59375739 CACTGGGAATAGGAGGAGCAAGG - Intronic
908966998 1:69777420-69777442 CAGAGAGAAAAGCAAGATCAAGG - Intronic
909751080 1:79161875-79161897 CAGAGGGAATAGCAGGTAGAAGG + Intergenic
910161689 1:84278896-84278918 CAGAGGGAATATGAGGAGAAAGG + Intergenic
911152410 1:94608223-94608245 AAGAGGGAACTGCAGGCCCAAGG - Intergenic
911190406 1:94942918-94942940 CAGACGGAGTAGCAGGACAAAGG - Intergenic
911801492 1:102144753-102144775 GAGAGGGAAGAGCAGGGCAAGGG - Intergenic
913264812 1:117033923-117033945 CAGAAGGAGGAGCAGGACGAAGG - Exonic
914453282 1:147812068-147812090 CAGATGAACTTGCAGGACCAAGG + Intergenic
914679599 1:149929766-149929788 CAGAGGAGATAGCAGGTCGAGGG + Exonic
915164864 1:153942791-153942813 CAAAGGGCATCCCAGGACCAAGG - Intronic
915191869 1:154157601-154157623 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
916581142 1:166110307-166110329 CCCAGGGAATAGCAGGATCAGGG - Intronic
918152095 1:181806367-181806389 AAGAGGGAATGGCCTGACCATGG - Intronic
918790704 1:188823555-188823577 CAGAGGGCAAAGCAGGAGAATGG - Intergenic
919712175 1:200739281-200739303 CGGAGGGACGAGCAGGACGAGGG - Intergenic
919741535 1:200984053-200984075 CAGAGAGCAAAACAGGACCAGGG + Intronic
920259393 1:204678674-204678696 CAGAGGGGACAGCAGGTGCAAGG - Intronic
920750375 1:208669192-208669214 GAGAGGTAACTGCAGGACCATGG - Intergenic
921982522 1:221273911-221273933 CAGAGGGGAGAGCAGTACAAGGG + Intergenic
922677074 1:227559771-227559793 CAGAGGGGATCCCAGGACCCAGG + Intergenic
924495764 1:244586858-244586880 CAGAGGGAGAACCAGGACCCTGG + Intronic
1063691270 10:8289704-8289726 CAGAGGGAATGAGAAGACCAGGG + Intergenic
1064577613 10:16762010-16762032 CAGGGGGAACAGCAAGACCGGGG - Intronic
1064931875 10:20637548-20637570 CCGAGGGAAAAGCAAGACTAAGG + Intergenic
1065830835 10:29612204-29612226 CCCAGGGAATAGGAGGAGCATGG + Intronic
1066391602 10:34981270-34981292 CAGAGGAAAGAGTAAGACCATGG + Intergenic
1067477153 10:46574668-46574690 CAGAGGCCATAGCAGGATAAAGG - Intergenic
1067617586 10:47767113-47767135 CAGAGGCCATAGCAGGATAAAGG + Intergenic
1068740686 10:60466052-60466074 GAGAGTGAGTGGCAGGACCATGG - Intronic
1068922686 10:62501306-62501328 CAGAGGGAAGAGCATGTGCAAGG - Intronic
1070525554 10:77293046-77293068 CAGAGGGAACAGTAGGTCAAAGG + Intronic
1070746647 10:78937790-78937812 CAGAGGGAATAGCCACACCCAGG - Intergenic
1071172150 10:82878941-82878963 CTGAGGGAAAGGCAGGACAAAGG - Intronic
1071532904 10:86402444-86402466 CGGTGGGAATGGCAGCACCATGG + Intergenic
1071730906 10:88247495-88247517 CAGAGAGAATAGCTGGCCCAAGG - Intergenic
1072425570 10:95327489-95327511 CAGAGGGATTAACAGCTCCAGGG - Intronic
1072854938 10:98936582-98936604 CATAGGGAAGAGCAGAAACAGGG - Intronic
1074469628 10:113715316-113715338 CACAGGGCATGGCAGGACCCAGG - Intronic
1074781765 10:116807354-116807376 AAGAGGGGAAAGCAGGTCCAGGG - Intergenic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1075071690 10:119324186-119324208 CAGAGAGAATAGCAAGAGCCAGG + Intronic
1075895284 10:125989818-125989840 CAGAGGGCATTGCAGGAGAAGGG + Intronic
1077214009 11:1387719-1387741 AAGAGGGGACAGCAGGGCCAAGG + Intergenic
1078040774 11:7860936-7860958 CAGAGGGAACAGCAGGCTGAGGG + Intergenic
1078914717 11:15768674-15768696 AAGAGGAAAGAGCAGGACAAAGG - Intergenic
1080379504 11:31753382-31753404 CAGAGGGAATAGCAATATCAAGG - Intronic
1080835856 11:35940363-35940385 CAGAGACACTAGAAGGACCAAGG - Intergenic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081192260 11:40118622-40118644 CAGAGGGATCAGCTGAACCAAGG + Intronic
1081852795 11:46285400-46285422 CAGACTGAATGGCAGGACCCTGG + Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083280969 11:61627138-61627160 CAGAGGCAGGAGCAGGCCCAGGG - Intergenic
1083887139 11:65578390-65578412 AAGAGGGAATGGCAAGTCCAAGG - Intronic
1083925586 11:65804112-65804134 CAGAGGTAATAACAGGGCAAGGG + Intergenic
1083944580 11:65916947-65916969 CAGAGGGGATGCCAGGACCATGG - Exonic
1084046421 11:66570831-66570853 CAGAGGGAAGAGCATAATCAAGG - Intergenic
1085826520 11:79853446-79853468 CTGAGGGAACAGCACGAGCAGGG - Intergenic
1085960687 11:81458039-81458061 CAGAGGGACTAGCAGGTGAAAGG - Intergenic
1086308485 11:85508362-85508384 CAGAGGGAATAGCAAGTGCAAGG - Intronic
1086336718 11:85808581-85808603 CAGATGGAGAAGTAGGACCAAGG - Intronic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1089045500 11:115498915-115498937 CAGAGGGGATAGAGCGACCAGGG + Intronic
1089742623 11:120595190-120595212 GAGAGGGCACAGCACGACCACGG - Intronic
1090197258 11:124827280-124827302 CAGAGGGAATAGCAAGTGCCAGG - Intergenic
1090427891 11:126622410-126622432 CAGAGGGACCAGTAGCACCATGG - Intronic
1090464997 11:126925732-126925754 CAGAGAGAAGTGCAGGAGCAGGG - Intronic
1091258262 11:134210826-134210848 CAGAGGGAATTTCTGGACAACGG + Intronic
1091404745 12:202198-202220 CAGGGGGAAGAGCAGGTGCAGGG - Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1092163341 12:6328021-6328043 AAGAGGGCAAAGCAGGAACAGGG + Intronic
1092997398 12:13963167-13963189 TAGAGAGAATGGCAGGAGCAAGG - Intronic
1095120676 12:38414548-38414570 CAGAGGGAAGAAGAGGACCAAGG + Intergenic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1097250786 12:57631448-57631470 CAGACAGAATTGCAGGGCCAAGG - Intronic
1097686995 12:62700368-62700390 TAGGAAGAATAGCAGGACCAAGG - Intronic
1098095522 12:66951368-66951390 CAGAGCAAATAGCAGCACAAAGG + Intergenic
1099009703 12:77277238-77277260 AAGAGGGAAAAGGAAGACCAAGG - Intergenic
1099735015 12:86555839-86555861 GAGAGAGAAAAGCAGGTCCAGGG - Intronic
1101287161 12:103326627-103326649 CAGAGGGAACAGCAAAAGCATGG - Intronic
1101415953 12:104508167-104508189 CAGAAGGAACAGCAGTACAAAGG - Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101605828 12:106247391-106247413 CAGAGGGAGGAGCTGGGCCAGGG - Exonic
1102409214 12:112702656-112702678 AAGAGGGAAGAGCTGGACCAAGG + Intronic
1102530137 12:113540230-113540252 CACAGGGAATCCCAGAACCAGGG + Intergenic
1102730868 12:115108217-115108239 CAGAGGGAAAAGCAAGTGCAAGG - Intergenic
1102976049 12:117207835-117207857 GAGAGGGAAAAGAAAGACCAGGG - Intergenic
1104165849 12:126229107-126229129 CAGAGGGAAGAACAGGTGCAAGG + Intergenic
1104492057 12:129202743-129202765 CAGAGGGAATGGCATGAGGAAGG - Intronic
1105001120 12:132689394-132689416 CACAGGGAACAGCAGGGCAAAGG + Intronic
1105255423 13:18741274-18741296 CAGAGGGAAAAGCAGAATTAAGG + Intergenic
1105425749 13:20293295-20293317 CAGAGGGAATGGCTACACCAGGG - Intergenic
1106242929 13:27924754-27924776 CAGAGGGCCTAGGAGGACCCCGG + Exonic
1106993207 13:35449016-35449038 CAGAGGGAATAACATTAGCATGG + Intronic
1108482881 13:50892532-50892554 AAGAGGAAATAGAAGGGCCATGG + Intergenic
1108523819 13:51268306-51268328 CTGAAGAAATAACAGGACCAAGG + Intronic
1110413959 13:75232295-75232317 CAGAGGGAACAGAAGGTGCATGG - Intergenic
1111496404 13:89056174-89056196 AAGAGGGTATAGGAGGAACACGG + Intergenic
1111927867 13:94482379-94482401 CAGAGGGAATGGCAAGACAAAGG - Intergenic
1112950383 13:104988371-104988393 AAATGAGAATAGCAGGACCATGG + Intergenic
1113391625 13:109903400-109903422 CTGAGGGAATAGCAGGAGAGAGG + Intergenic
1113447889 13:110384562-110384584 CAGAGGACATAGCAAGTCCAGGG - Intronic
1113803872 13:113102230-113102252 AAGGGTGAAAAGCAGGACCAAGG + Intergenic
1115061878 14:29201960-29201982 GAGAGGTAATAGAAGAACCAGGG + Intergenic
1115148366 14:30253704-30253726 TAGAGGGAAACGCAGGACCTGGG + Intergenic
1115155441 14:30333673-30333695 CAGAGGTAAAAGCCAGACCAGGG - Intergenic
1115175706 14:30559309-30559331 CAGAGAGAGAAGCAGGACCGTGG + Intronic
1116916338 14:50529781-50529803 GAGAGGAAATAGCAAGAACAAGG + Intronic
1117387538 14:55231062-55231084 CAGAGGGAATAGCAGTAGTTGGG + Intergenic
1118412115 14:65491467-65491489 CAGTGGGAATATCAGCAGCATGG + Intronic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121103801 14:91267746-91267768 CTGATGGAGTAACAGGACCACGG + Intergenic
1121432522 14:93898053-93898075 CAGAGGCAACAGGAGGCCCAGGG + Intergenic
1122580590 14:102769216-102769238 CAGAGGGAACAGCAGGTGCCAGG + Intergenic
1122954625 14:105064913-105064935 CAGAGGGAAAAGCAGGGCAGTGG - Intronic
1125158247 15:36614216-36614238 CAGAGGGAGGAGCAGCAGCAGGG - Intronic
1125748558 15:42013442-42013464 CCGAGGGAACAGCATGAACAAGG + Intronic
1126592946 15:50357832-50357854 CAAAGGGAATAGCTGGGCAAAGG + Intergenic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127699128 15:61479990-61480012 CAGAGGAAATAGCAAGTGCAAGG + Intergenic
1127854557 15:62943651-62943673 CAGAGGGAACTGCAGTGCCAAGG - Intergenic
1128518631 15:68360733-68360755 CAGAGGAAATGGCAGAGCCAGGG - Intronic
1128532755 15:68465685-68465707 CAGAGAGAATAACATGAACAAGG - Intergenic
1128842886 15:70864395-70864417 GAGAGGGAAGAGCAGGGCCCTGG + Intronic
1129322156 15:74781501-74781523 CAGAGGGAACAGCATGCACAAGG - Intergenic
1129684026 15:77674606-77674628 CAGAGGGAACAGCAGGTCTGAGG - Intronic
1130257348 15:82331956-82331978 CACTGGGATTAGCAGGACCCTGG - Intergenic
1130597597 15:85258033-85258055 CACTGGGATTAGCAGGACCCTGG + Intergenic
1131105551 15:89731643-89731665 CAGAGGTAACAGAAGGCCCAGGG - Intronic
1131121750 15:89827437-89827459 CAGAGGGGATGGCAAGACAAAGG + Intergenic
1131261060 15:90888021-90888043 TAGAGGGTCTAGCAGGGCCATGG + Intronic
1131569206 15:93516599-93516621 CAGCGGGGACAGCAGGAGCAGGG - Intergenic
1131820782 15:96271543-96271565 CTGAGGGAATAGCAGTGCAAAGG - Intergenic
1132196025 15:99915459-99915481 CCCAGGGAATAGCAGGACATTGG + Intergenic
1134271969 16:12740753-12740775 CAGAGTGAACAGCAGGTGCAAGG + Intronic
1134689421 16:16181512-16181534 CAGAGGGAACAGCAGTGCAAAGG + Intronic
1135058055 16:19247102-19247124 CAGAGGGAACAGCAACACAAAGG + Intronic
1135469959 16:22721551-22721573 GAGAGGCAATAGCAGAAACAGGG - Intergenic
1135709342 16:24701702-24701724 CAGAAGGGATAGCAGGGCCATGG - Intergenic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136123875 16:28162140-28162162 GAAAGAAAATAGCAGGACCATGG + Intronic
1137537951 16:49341830-49341852 CAGAGGGAGTGGCAGGGCAAAGG + Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1138248758 16:55486293-55486315 CAGAGGCAGCATCAGGACCAAGG - Intronic
1138448338 16:57078357-57078379 CAGAGGGCTTCGCAGGAGCACGG + Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1139002093 16:62524443-62524465 CAGAGGGAGTTGCATGAGCATGG + Intergenic
1139558583 16:67727937-67727959 AAGAGGGAAGGGCAGGACTAGGG + Intronic
1139927825 16:70501107-70501129 CAGAAGGAATAGGACGACAATGG + Intronic
1141309555 16:82900123-82900145 CAGAGGGAATGGCAGCTGCAAGG - Intronic
1142571551 17:878226-878248 CGGAGGGAATCCCAGGAGCAGGG + Intronic
1142676972 17:1519686-1519708 CAAAGGGAAGAGGAGGAGCAGGG + Exonic
1142881865 17:2888036-2888058 CCCAGGGAATAGCAGGAGCTTGG + Intronic
1143014626 17:3885113-3885135 GAGTGGGAATAGCAGGACTTAGG + Intronic
1143624620 17:8102630-8102652 GAGGGGGAAGAACAGGACCAAGG - Intronic
1143883701 17:10050547-10050569 CAGATGGCACAGCAGAACCAAGG + Intronic
1144042121 17:11421352-11421374 AAGAGGAAATAACAGCACCAGGG + Intronic
1144161203 17:12560618-12560640 CAGAGTGAATAAGATGACCAGGG - Intergenic
1144761026 17:17707480-17707502 CAGAGGGAATAGCAGTGCAAAGG + Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145792750 17:27638110-27638132 CAGAGGGAGTCGCAGCCCCACGG - Intronic
1145807618 17:27745979-27746001 CAGAGGGAGTCGCAGCCCCACGG - Intergenic
1145914993 17:28567877-28567899 CAGAGGGAAAAGCATGTCTAAGG - Intronic
1146055553 17:29579009-29579031 CAGAGGGAAGAACAGGACAGAGG + Intronic
1146458152 17:33023144-33023166 CAGAGGGAATAGAACGTGCAAGG + Intronic
1146555238 17:33817380-33817402 CAGAGGGAGTAGCATGACAAAGG - Intronic
1146944762 17:36866073-36866095 GTTAGGGAATAGCAGGACCAGGG + Intergenic
1147866942 17:43559456-43559478 CTTAGGGAATATCAGGACCAAGG + Intronic
1148130342 17:45258362-45258384 CTGGGGGAACAGCAGGACCTGGG - Intronic
1148817781 17:50343000-50343022 CAGAGGGAAAGCCAGGATCAGGG + Intergenic
1149291870 17:55225421-55225443 CAGAGGGCACAGGAGGAGCAGGG - Intergenic
1154032376 18:10765224-10765246 CAGAAGAAATAGCAGGTCCAAGG + Intronic
1154217609 18:12426863-12426885 CAGAAGGAACAGCAAAACCATGG + Intronic
1154435594 18:14339330-14339352 CAGAGGGAAGAGCAGAATTAAGG - Intergenic
1156025165 18:32645305-32645327 CAGAGGTTATTGCAGGATCATGG - Intergenic
1156382886 18:36579894-36579916 AAGAGGGAGGAGAAGGACCACGG + Intronic
1156528394 18:37790953-37790975 TAGAGGGGATAGCATGAGCAAGG + Intergenic
1157181087 18:45498759-45498781 TGGAGGGGAAAGCAGGACCAAGG - Intronic
1157652076 18:49343365-49343387 CAGAGGGAACAGCAGCTTCAAGG - Intronic
1160107564 18:75992541-75992563 GAGGGGGAAAAGCAGGACAAAGG - Intergenic
1160705002 19:525489-525511 GAGAGGGAACAGCACGTCCAGGG - Intergenic
1161359389 19:3838760-3838782 AAGAAGAAAAAGCAGGACCAGGG - Intronic
1162721526 19:12665646-12665668 CAGAGGGATTACAGGGACCATGG + Intronic
1162922142 19:13909531-13909553 CAGTGGGAAAAGCAGGCCCCTGG - Intronic
1162925642 19:13929618-13929640 CAGAGGGCACAGCTGGAGCAGGG + Exonic
1163556976 19:17998558-17998580 CAGAGGGCAGGGCTGGACCATGG + Exonic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1164670766 19:30070776-30070798 CAGAGGGAGTGGCAGGGGCAGGG - Intergenic
1165335772 19:35168690-35168712 CAGAGGGAACAGCAGCGCAAAGG - Intronic
1165432726 19:35781709-35781731 CAGAGGGAGCAGCAGGGCAAAGG + Intronic
1165649284 19:37471341-37471363 CAGAGAGAATAGCAAGTGCAAGG - Intronic
1166243023 19:41506913-41506935 CAGAGGGAGGAGCAGCAGCAGGG - Intergenic
1166333532 19:42091956-42091978 CAGAGGCATTAGCAGGGGCAGGG + Intronic
1166822577 19:45589574-45589596 CAGAGGGAACTGCAGGTGCAAGG - Intronic
1167077492 19:47258300-47258322 CAGAGGGAAAAAAAGGACAAAGG - Intronic
1167259880 19:48452433-48452455 CAGAGGGAAGAGCAGGGGCGGGG + Intronic
1167687272 19:50964171-50964193 CAGAGGGAACAGCAGTGCAAAGG - Intronic
925797912 2:7566802-7566824 CAGAGGGAAGAGCATGTGCAAGG - Intergenic
926152938 2:10434750-10434772 CAGGGGGACAGGCAGGACCAAGG + Intergenic
926335144 2:11857282-11857304 CATGGGGAATACCAGGGCCAGGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
927106223 2:19829740-19829762 CAGAGGGAATAGCAGGTACCAGG + Intergenic
927523031 2:23712599-23712621 CAAAGGGAATATCATGACCTTGG + Intergenic
927766116 2:25809887-25809909 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
928102919 2:28449824-28449846 GAGAGGGAAGATCAGGGCCAGGG - Intergenic
929494135 2:42424872-42424894 CAGAGGGAAATGCAGGACCCCGG + Intronic
930186976 2:48420350-48420372 CAGAGGGAACGGGAGGCCCAGGG + Intergenic
931067387 2:58601710-58601732 CAGAGAGAATAGTAACACCAAGG - Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
935541573 2:104354509-104354531 GGGAGGGAATGGCAGGTCCAGGG + Intergenic
937214027 2:120299215-120299237 CAGATGGAGCAGCAGAACCACGG - Intergenic
937239009 2:120448217-120448239 GAGAAGGAATATCAGGATCAAGG - Intergenic
939076552 2:137609469-137609491 CAGAGGGAACAGCAAGATCAAGG + Intronic
939860802 2:147417749-147417771 CAGAGGTACTAGCAAGTCCAAGG - Intergenic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
940924751 2:159352208-159352230 CAGAGGGAAGAACAAGATCAAGG - Intronic
940927550 2:159381852-159381874 CAGAGAGAAATGCATGACCAAGG - Intronic
941155727 2:161975787-161975809 CAGAGGGAAGAGCAAGGACAAGG + Intronic
941465817 2:165825562-165825584 CAGAGGGGATAGCATTATCAAGG - Intergenic
942642287 2:178072638-178072660 GAGCAGGAGTAGCAGGACCACGG - Exonic
942947461 2:181685191-181685213 CAAAGGGGATCGCAGGGCCAGGG + Intergenic
943051266 2:182916074-182916096 GAGAGGGAGGAGCAGGAGCAGGG - Intronic
944448472 2:199816628-199816650 CAGAGGGAATAGCCAGTGCAAGG - Intronic
945160324 2:206883945-206883967 GAGAGAAAATAGAAGGACCAGGG - Intergenic
945778268 2:214134260-214134282 AAGAGGGAAGAGCAAGATCAAGG - Intronic
946134526 2:217634886-217634908 CAGAGGGAGCACCAGGACAAAGG + Intronic
946273837 2:218615848-218615870 CAGAGAGGGTAGCAGGCCCAGGG - Intronic
946884349 2:224208262-224208284 CAGAGGGAATAACAAGTCCAAGG + Intergenic
947488398 2:230573127-230573149 CAGAGGGAGGAGCAGCAGCAGGG + Intergenic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
948370697 2:237487452-237487474 AAGAGGGAACAGCGGGGCCAGGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948755954 2:240159632-240159654 CAGAGGGAACCGCTGGACAAAGG - Intergenic
1168846636 20:949703-949725 CAGAGGGGATAGCAAGTGCAAGG + Intergenic
1168976482 20:1969803-1969825 CAGAGAGAAGAGCAAGAGCAAGG - Intergenic
1169391820 20:5196950-5196972 CAGGAGGAATACCAGGGCCACGG + Exonic
1169960709 20:11156928-11156950 CACAGGTAATAGAAGGACCCAGG - Intergenic
1172014123 20:31862891-31862913 CAGAGGGAACAGCATGGCAAAGG - Intronic
1172459349 20:35104251-35104273 CAGAGGCAACAGCATTACCAAGG - Intergenic
1172702284 20:36861081-36861103 CAGAGTGAGTAGCAGGAACCGGG + Intronic
1172956983 20:38767916-38767938 CAGAAGGACTAGCATGAGCAAGG + Intronic
1173552721 20:43944470-43944492 CAGAGGGAACAGCATGAAAAAGG + Intronic
1173583680 20:44165746-44165768 TAGAGGGAACAGCAATACCAAGG - Intronic
1173870517 20:46339117-46339139 CAGAGGGAACAGCAAGTCTAAGG + Intergenic
1174231464 20:49048585-49048607 TAGAGGGAATAGAAGGCTCAAGG + Intronic
1174289562 20:49498244-49498266 CTGTGGAAATAGCAGGAGCAAGG - Intergenic
1174946813 20:54995239-54995261 AAGAGGGAACAACAGGACAAGGG - Intergenic
1176841438 21:13846303-13846325 CAGAGGGAAGAGCAGAATTAAGG + Intergenic
1179158578 21:38873514-38873536 CAGAGGGAGTATCAGGACAATGG - Intergenic
1181290839 22:21791786-21791808 CCCAGGGAACAACAGGACCATGG + Intronic
1181395189 22:22616449-22616471 AAGAGGGGAGAGCAAGACCAGGG - Intergenic
1181409635 22:22710050-22710072 AAGAAAGAAGAGCAGGACCAGGG - Intergenic
1181429063 22:22866745-22866767 CAGAGGGGTTTGCAGAACCAGGG + Intronic
1181731080 22:24847301-24847323 CAGGGGGCATAGCTTGACCAAGG - Intronic
1182015129 22:27032767-27032789 CAGAGGGAAGAGGAGAACCAGGG - Intergenic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182051339 22:27315104-27315126 CAGAGGGAACAACAGGTGCAAGG + Intergenic
1182234730 22:28866358-28866380 CTGAGGGAATAGCAGGATGAGGG + Intergenic
1182892255 22:33828879-33828901 GAGAGGGAATAGCAAGTACACGG - Intronic
1183514858 22:38259236-38259258 CAGAGGGGATAGCAGCAGTAAGG - Intronic
1183722089 22:39568567-39568589 GAGAGGGAAGAGCGGGAGCAGGG + Intergenic
1184207506 22:43014681-43014703 GAGAGGGAAGTGCAGGAGCAGGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184513671 22:44947198-44947220 CACTGAGAATAGCAGGGCCAAGG - Intronic
1184763180 22:46557173-46557195 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1185071593 22:48659597-48659619 CAGGGAGAAAAGCAGGACAAGGG - Intronic
1185140374 22:49097549-49097571 TGAAGGGAATAGCAGGGCCATGG - Intergenic
1185218059 22:49614896-49614918 CAGAAGGAATAGCTCCACCAGGG + Intronic
949648995 3:6133046-6133068 GAGAGGGAAAAGAAGGACCCTGG + Intergenic
949745579 3:7288480-7288502 CAGAGCCAAACGCAGGACCAGGG - Intronic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950640139 3:14343465-14343487 CAGAGGGAATAGCATGGCAAGGG - Intergenic
950681134 3:14585858-14585880 CAGAGGGGACAGCAGGTGCAAGG + Intergenic
950762339 3:15243151-15243173 CAGAGGGAACAGCAAGTACAAGG + Intronic
952060223 3:29499117-29499139 CAGAGTGAATAGCATAACAAAGG - Intronic
952475969 3:33711014-33711036 AAGAGGTACTAGTAGGACCAAGG + Intronic
952916627 3:38250818-38250840 CAGAGGGAACAGGAGGACTGCGG - Intronic
953127676 3:40107588-40107610 CAGAGGAAATAGCAGGTATAAGG + Intronic
953498656 3:43411624-43411646 CAGAGAGAGAAGCAGCACCATGG - Intronic
954652683 3:52175000-52175022 CAGAGGGAATAGCTGTGCAAAGG - Intergenic
954746003 3:52787917-52787939 CAGAGGGATCAGCAGCTCCAGGG + Intronic
955718781 3:61860259-61860281 AAGATGGAATAGCATGACTAGGG - Intronic
955798170 3:62659433-62659455 CTGAGGGAAAAGCAGGTACATGG + Intronic
955873163 3:63461331-63461353 CAGAGGGAGTAGGAGGAGCTGGG - Intronic
956173210 3:66449475-66449497 CTAATGGAATAGCAGGAACAAGG + Intronic
956815686 3:72906276-72906298 CAGAGGGGACAGCAGAACAAAGG - Intronic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957168589 3:76708334-76708356 CAGAGGGAACAGAAGCACAACGG + Intronic
959859219 3:111197725-111197747 CAGACCTTATAGCAGGACCAGGG + Intronic
960264602 3:115605986-115606008 CAGATGGAATAGTAAGCCCAGGG + Intergenic
961185314 3:124910077-124910099 TATAGGCAATAGCAGGACCATGG - Intronic
961492477 3:127265153-127265175 CAGAGGGAGCGGCAGGGCCAGGG + Intergenic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962992686 3:140593299-140593321 CACAGGGCATAGCATGAACAAGG - Intergenic
964728718 3:159842664-159842686 CAGAAGGAATAGCAGGTGCAGGG - Intronic
964816836 3:160726895-160726917 CAGAGGGAATAGCAGGTGCAAGG - Intergenic
967100491 3:186211507-186211529 AAGAGGGAATCGCAAGGCCACGG + Intronic
967279825 3:187811130-187811152 CAGTGGAAATAGCAAGGCCAAGG + Intergenic
968944640 4:3657260-3657282 GAGAGGGAAGAGGGGGACCAGGG - Intergenic
969198262 4:5580619-5580641 CAGAGGGAAGAGCAGGTCCAAGG - Intronic
969387784 4:6867345-6867367 CAGAAGGAACAGCAGAAGCAAGG + Intronic
969532327 4:7736837-7736859 CAGAGGGAATCCCAGGGCCAAGG + Intronic
969584732 4:8085139-8085161 CAGAGGGAAGCTCAGGGCCACGG + Intronic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
970860573 4:20698186-20698208 CAGAGCAAATAACAGGACAAAGG + Intronic
971936330 4:33152688-33152710 CAGATAGAATAACAGGAGCAGGG + Intergenic
972927128 4:44023367-44023389 CAGAGGAAAAATCAGGGCCATGG - Intergenic
973918689 4:55662724-55662746 CTGGGTGAAGAGCAGGACCAGGG - Intergenic
974100609 4:57411899-57411921 CAGAGGGCAAAGTAGGAGCAAGG - Intergenic
974336116 4:60546984-60547006 AAGAAGGAATAGCAGGTGCAAGG - Intergenic
975523990 4:75329433-75329455 CAGAGAAAATAGCATGTCCAAGG - Intergenic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
978188556 4:105886407-105886429 CAGAGAGAAAATCAAGACCAGGG + Intronic
980248765 4:130285006-130285028 CAGAGGGAATAGCCAGTGCATGG + Intergenic
980882340 4:138724671-138724693 CAGAGGGAACAGCAAAACAAAGG + Intergenic
982473406 4:155821649-155821671 TAAAGGGCATAGCAGGACAAGGG + Intergenic
984914281 4:184707187-184707209 CAGAGGGAATACCAAGAAAATGG + Intronic
985037245 4:185852916-185852938 GAGAGTGAACACCAGGACCAAGG - Intronic
985329993 4:188821521-188821543 CAGAGGGAAGAGCAAGAGCACGG + Intergenic
985445428 4:190018917-190018939 CAGAGGGGATCCCAGGACCGTGG + Intergenic
985505900 5:280219-280241 CAGAGGGCACAGCAGGGCAAAGG + Intronic
985742297 5:1625707-1625729 CAGAGGGCACAGCAGGGCAAAGG - Intergenic
987381357 5:17288855-17288877 CAGAGGGAACAGCTGGACAAAGG + Intergenic
987656243 5:20810434-20810456 AAGAGGGAATAGTAGGGGCAAGG - Intergenic
988767311 5:34393506-34393528 AAGAGGGAATAGTAGGAGCAAGG + Intergenic
988873539 5:35417977-35417999 CAGAGGGAAGAGGAGGAGAATGG - Intergenic
989166769 5:38440157-38440179 CAGAGGGAACTGCAGGACATTGG + Intronic
990345045 5:54863520-54863542 CAAAGGGAACAGCATGGCCAAGG - Intergenic
990851337 5:60208516-60208538 CAAAGAGAATAGCAGGACAATGG + Intronic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
992217556 5:74540857-74540879 CAGAGGGATTGGCTGGATCAGGG + Intergenic
992386275 5:76287631-76287653 CAGAGGGAACAGCAGCACTGTGG - Intronic
993003162 5:82403151-82403173 CAGAGTGAATAGCATGTGCAAGG + Intergenic
993478557 5:88394936-88394958 CAGAGGGAAAAGAAATACCACGG + Intergenic
994570267 5:101506030-101506052 CAGAGGCATAGGCAGGACCAGGG + Intergenic
997629208 5:135353941-135353963 CAAGGGGAATAGTAGGACCTGGG - Intronic
997986525 5:138505592-138505614 CAGATGGAATAGCAGAAACTAGG - Intergenic
998514580 5:142741296-142741318 CAGAGGGAAAAGCAGCAGCATGG - Intergenic
999227907 5:150042514-150042536 CAGAGGGAACAGCTCGAACAGGG + Intronic
999499571 5:152133123-152133145 CAGAGGGAAAATGAGGAACAAGG - Intergenic
999620714 5:153470201-153470223 CAGAGAGAATTGAAAGACCAGGG - Intergenic
1001092594 5:168752278-168752300 CAGAGGGAAGGGCATGTCCAAGG - Intronic
1001156688 5:169278607-169278629 CAGAGGAAGTAGCAGAAGCAGGG - Intronic
1001180905 5:169519577-169519599 CAAAGGGAATAACTGCACCATGG + Intergenic
1001493041 5:172168991-172169013 GAGAGGGAATGGCGGGACCCTGG - Intronic
1001646001 5:173283010-173283032 CGGTGAGAATAGCAGGGCCATGG - Intergenic
1001969972 5:175947651-175947673 CTGAGGGAACAACAGGAGCAGGG - Intronic
1002061399 5:176627978-176628000 CAGAGGGTATCCCAGGCCCAGGG + Intronic
1002247465 5:177896113-177896135 CTGAGGGAACAACAGGAGCAGGG + Intergenic
1003084185 6:3048384-3048406 AAGAGGGGACAGCAGGAACAGGG - Intergenic
1003123768 6:3339052-3339074 CAGAGGGAAGAGCAGGGTCGAGG + Intronic
1003339620 6:5207044-5207066 CAGAGTCAATACCACGACCAAGG + Intronic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1004638613 6:17492394-17492416 CAGAGGGTCTAGCAGGAACATGG + Intronic
1005594649 6:27367935-27367957 CAGAGTGGATGCCAGGACCAGGG - Intergenic
1006316977 6:33297181-33297203 CAGAGGGAGGAGCAGGGCCTGGG - Intronic
1007171552 6:39867708-39867730 CACAGAGAACAGCAAGACCAAGG + Exonic
1007293079 6:40801720-40801742 GAGAGGGAATAACAAGACTAAGG + Intergenic
1007642641 6:43354978-43355000 CAGGGGGAATGGCAGGTCCCTGG + Exonic
1009057932 6:58360670-58360692 CAGAGTGAATGGAAGAACCAGGG - Intergenic
1009232897 6:61086421-61086443 CAGAGTGAATGGAAGAACCAGGG + Intergenic
1009843397 6:69105735-69105757 CAGATGGAGTAGCATGCCCAAGG + Intronic
1011129075 6:84035560-84035582 CAGAGTGCATTGCAGGAGCAAGG + Intronic
1011994467 6:93567513-93567535 CAGAGGGGATATAGGGACCAGGG - Intergenic
1012501728 6:99895839-99895861 CAGAGGGAATAGCACATGCATGG - Intergenic
1012694410 6:102359484-102359506 CAGTGGGAAGAACTGGACCATGG + Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1015233513 6:130943904-130943926 CAGAGGGAATTGCAGGCTCCCGG - Intronic
1015431575 6:133136518-133136540 GAGAGGGAATAGCAATAACATGG - Intergenic
1016463383 6:144301924-144301946 CAGAGGTAAGAAAAGGACCATGG - Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1019018739 6:168900350-168900372 CGGAGGGAATATGAGGACAAAGG + Intergenic
1019078379 6:169410217-169410239 GAGAGGGAAGGGCAGGACCAGGG - Intergenic
1019920639 7:4161239-4161261 CAGAGAGCAGAGCAGAACCATGG + Intronic
1023158758 7:37277536-37277558 AAGAGGGAAGAGCAGGAGTAAGG + Intronic
1023473816 7:40554947-40554969 CAGAAGGAATAGCAGTTTCATGG - Intronic
1023765607 7:43507883-43507905 GAGAGGAAAGAGCAGGACCCAGG - Intronic
1023867873 7:44247383-44247405 CAGAGGGGAAGGCAGGGCCAGGG - Intronic
1025814482 7:64898665-64898687 CAGAGGGATTACTAGGAACATGG - Intronic
1029633558 7:101768615-101768637 CAGAGGGAACAGCAGGTACAAGG - Intergenic
1030845231 7:114400972-114400994 AAGAGGAAATAGCAGGAGTAAGG + Intronic
1031053789 7:116972128-116972150 CAGAGGGAGGAGCAGCAGCAGGG + Intronic
1032450269 7:132024626-132024648 CAGAGGATATTGCAGGATCATGG + Intergenic
1032601761 7:133304434-133304456 CAGAGGGCAGAGCTGGCCCAGGG + Intronic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1035322646 7:158043407-158043429 CAGAGGGACTCTCATGACCAGGG + Intronic
1036648433 8:10626225-10626247 CAGAGTGAATAGCGGGAGGATGG + Intronic
1038046430 8:23769106-23769128 CAGGGGGAATGGCAGGTACAGGG - Intergenic
1038057207 8:23871724-23871746 CTGAGGTAAGAGCAGTACCAGGG - Intergenic
1038665024 8:29530357-29530379 CAGAGGGAAGAGGAGGTCCTTGG + Intergenic
1040491303 8:47924782-47924804 CAGAGGGAGACGGAGGACCATGG + Intronic
1041278823 8:56190935-56190957 CAGAGGAAATAGCACGTGCAAGG + Intronic
1041659981 8:60392014-60392036 CAGAGGGAAAAGCAGTGCAAAGG - Intergenic
1042844316 8:73155206-73155228 CAAAGGGGATAGCATGAGCAAGG - Intergenic
1042855352 8:73261435-73261457 AAGAGGGAAAAGGAGGAACAGGG + Intergenic
1043768042 8:84162491-84162513 CAGAGGGAAGAGCAGCGGCAGGG - Intergenic
1043963345 8:86443803-86443825 CATAGGGAACAGCAAGACAAAGG + Intronic
1044458183 8:92413384-92413406 CACAGGGAAAGGCAGCACCATGG - Intergenic
1045208529 8:100069324-100069346 CATAGGGAGTAGCAGCACAAGGG + Intronic
1045705964 8:104923040-104923062 CATAGGGAATAGCATTAACAAGG - Intronic
1045808626 8:106195156-106195178 CAGATTTAATAGCAGGAACAAGG - Intergenic
1046323810 8:112614153-112614175 CAGAGGGAATAGCAAATACAGGG + Intronic
1048186277 8:132244073-132244095 CAGGGGGTGTAGGAGGACCAGGG - Intronic
1048555999 8:135476558-135476580 CAGAGGGAAAAGCAAGTGCAAGG - Intronic
1048811239 8:138288501-138288523 CAGAGGGAAAAGCAGAGACAGGG + Intronic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1049188554 8:141272670-141272692 CAGAGGGTATAGCAGGAGTAGGG - Intronic
1049453398 8:142674976-142674998 CAGAGGGAATAGCAGGCACGGGG - Intronic
1051783349 9:20714559-20714581 CAGGTGGTAAAGCAGGACCATGG - Intronic
1055069778 9:72154382-72154404 CAAAGGGAATAGAATGAACATGG - Intronic
1057282762 9:93724816-93724838 CACAGGGAAGAGCATGAGCAAGG + Intergenic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1059397972 9:114050700-114050722 AAGAGGGAAAAGGAGGACCGGGG - Exonic
1060544381 9:124451673-124451695 CAGAGGAAACAGTAGCACCACGG - Intronic
1060849974 9:126866483-126866505 CAGAAGGAAAAGCAGGAACAGGG - Intronic
1060853181 9:126894499-126894521 CAGAGGGAACAGCACGTGCAAGG + Intergenic
1061618463 9:131795206-131795228 CTGAGGAAATAGCAGGTGCAAGG - Intergenic
1061625369 9:131838129-131838151 CAGATGGAATGGGAGGAGCAAGG + Intergenic
1061864613 9:133485842-133485864 CAGGAGGAACAGCAGGACAAGGG - Intergenic
1062017009 9:134296069-134296091 CAGAGGGAATGGCCGGTGCAAGG - Intergenic
1062270486 9:135705966-135705988 TGGAGGGCATTGCAGGACCAGGG + Intronic
1192426190 X:71079023-71079045 CAGAGGGAATAGCAAGTATAAGG - Intergenic
1194740291 X:97564519-97564541 CAGAAGGAGTAGAAGGGCCAGGG + Intronic
1195427061 X:104746265-104746287 CAGAGGAAAAACCAGGACCTTGG - Intronic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197800552 X:130343268-130343290 GAGATGGAAAAGCAAGACCATGG - Intronic
1198610674 X:138396244-138396266 CAGAAGGCAAAGCAGGAGCAGGG - Intergenic
1199581833 X:149368303-149368325 CAAAGACAACAGCAGGACCAGGG + Intergenic
1199950075 X:152699860-152699882 CTGAGGTAACAGCAGGAGCAGGG - Intronic
1199954984 X:152735325-152735347 CTGAGGGAATAGCAGGGGCAGGG - Intronic
1199959599 X:152768601-152768623 CTGAGGTAACAGCAGGAGCAGGG + Intronic
1200063743 X:153495187-153495209 CACTGGGGACAGCAGGACCAGGG - Intronic
1201065404 Y:10090937-10090959 CGGAGGGGATCCCAGGACCATGG - Intergenic
1201236612 Y:11917961-11917983 CAGAGGGGCTAGCAGGGGCAAGG + Intergenic
1202119664 Y:21509826-21509848 CAGGGAGAATAGCAGCGCCAAGG - Intergenic
1202122117 Y:21533367-21533389 CAGGGAGAATAGCAGCGCCAAGG - Intronic
1202156890 Y:21896016-21896038 CAGGGAGAATAGCAGCGCCAAGG + Intronic
1202159336 Y:21919557-21919579 CAGGGAGAATAGCAGCGCCAAGG + Intergenic
1202185784 Y:22184472-22184494 CAGGGAGAATAGCAGCGCCAAGG + Intergenic
1202205576 Y:22401924-22401946 CAGGGAGAATAGCAGCGCCAAGG - Intronic