ID: 947507041

View in Genome Browser
Species Human (GRCh38)
Location 2:230715667-230715689
Sequence TTGCTACTATAACAAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947507041 Original CRISPR TTGCTACTATAACAAATGGG TGG Intronic
901331806 1:8415259-8415281 TAGCTAGTAAAACAAATGGAAGG - Intronic
907224557 1:52933075-52933097 TTTCTACTAGAAGAAATGGCTGG + Intronic
907698507 1:56758790-56758812 TGGGTGCTATAAGAAATGGGTGG - Intronic
908144249 1:61220759-61220781 TTTCTGCAATAACAAATTGGAGG - Intronic
909263070 1:73519993-73520015 TTGCTAGTATATCAACTGGATGG - Intergenic
909452821 1:75817732-75817754 TGATTTCTATAACAAATGGGAGG + Intronic
913968000 1:143392843-143392865 TTTCTACTAAAAGCAATGGGAGG - Intergenic
914062381 1:144218433-144218455 TTTCTACTAAAAGCAATGGGAGG - Intergenic
914116769 1:144747921-144747943 TTTCTACTAAAAGCAATGGGAGG + Intergenic
915298794 1:154940446-154940468 TGGCTACTGTAGGAAATGGGAGG - Intergenic
915301912 1:154956564-154956586 TTGCTACTTTAAAAAACGGTTGG + Intergenic
920269885 1:204754941-204754963 TTGCTACCATACCAAGTGGTGGG - Intergenic
1072148141 10:92661601-92661623 TTACTAATAAAACAAATAGGCGG - Intergenic
1072908094 10:99473732-99473754 TTGCCACTATAAAAAATAGCAGG - Intergenic
1073905983 10:108280326-108280348 TTGCTTCTATAGCAAATGACAGG + Intergenic
1078155966 11:8800306-8800328 TTGCTAATAAACTAAATGGGAGG + Intronic
1080141303 11:28923735-28923757 TTGCTACAGTAACAAGTGGATGG + Intergenic
1080342877 11:31287975-31287997 TTGCTACTATCACCAATAGCAGG - Intronic
1081137735 11:39459886-39459908 TTGCTACTACAACAAATCTAGGG + Intergenic
1081407794 11:42717789-42717811 TGGCTATTTTAACAAAAGGGAGG - Intergenic
1093465948 12:19449223-19449245 TTGCTTCTTTATTAAATGGGGGG + Intronic
1095735182 12:45548422-45548444 TTGCTGCTGTAACAAATTAGTGG - Intergenic
1104240997 12:126989536-126989558 ATGCATCTATTACAAATGGGAGG - Intergenic
1105577024 13:21663090-21663112 TTGATGCTATAACAAATGCCTGG - Intergenic
1106702227 13:32242335-32242357 TTTATAGTATTACAAATGGGGGG - Intronic
1107209136 13:37831340-37831362 TTGATATTCTAACAGATGGGAGG - Intronic
1108135623 13:47354745-47354767 TAGCCATTATAACAAATGTGAGG + Intergenic
1109909883 13:68895479-68895501 TTGGTCCCATAACAAAGGGGGGG - Intergenic
1116003769 14:39270792-39270814 TTGCTCATTTAAAAAATGGGTGG + Intronic
1119250967 14:73153617-73153639 TTTCTACAATGACAAATGTGGGG - Intronic
1120371890 14:83646021-83646043 TTGCTTCTTTAAAAAATGGCTGG - Intergenic
1121150554 14:91629786-91629808 TTCCTACTATTGCACATGGGGGG + Intronic
1123481993 15:20640737-20640759 TTGCTACTGTAAGAGATGGTGGG - Intergenic
1123636019 15:22359628-22359650 TTGCTACTGTAAGAGATGGTGGG + Intergenic
1125348086 15:38740114-38740136 TTGCTAGTAGAAGAAATGTGGGG + Intergenic
1127705398 15:61541926-61541948 TTACTACTATAAGAAAAGGAAGG + Intergenic
1138770028 16:59652220-59652242 TTGCTGCTAGAACAAATTGTGGG - Intergenic
1141366732 16:83450382-83450404 TTGCTCCTCTGAAAAATGGGTGG + Intronic
1143912461 17:10262978-10263000 TTGCTACTATAAACAATGATTGG - Intergenic
1150363085 17:64555085-64555107 TTTATAATATAACAAATGTGAGG + Intronic
1153972992 18:10243372-10243394 TTGCTAAGAGAACAAAAGGGAGG - Intergenic
1155969502 18:32068433-32068455 ATGCTGCTTGAACAAATGGGAGG + Exonic
1160375108 18:78405800-78405822 TTGCTGCCTTAACAAATGGAAGG + Intergenic
1202701789 1_KI270712v1_random:170311-170333 TTTCTACTAAAAGCAATGGGAGG - Intergenic
927285749 2:21355098-21355120 TGGCTACATTAATAAATGGGTGG + Intergenic
930633232 2:53777277-53777299 TTGATACTATAATGATTGGGTGG - Intronic
931458406 2:62430256-62430278 TTGCTACAGTTATAAATGGGGGG + Intergenic
934172699 2:89553758-89553780 TTTCTACTAAAAGCAATGGGAGG - Intergenic
934283014 2:91628110-91628132 TTTCTACTAAAAGCAATGGGAGG - Intergenic
935533887 2:104270006-104270028 TTATTACTGTAACAATTGGGGGG + Intergenic
946978742 2:225183193-225183215 TTGCTACCATTAAAAATGGAAGG - Intergenic
947507041 2:230715667-230715689 TTGCTACTATAACAAATGGGTGG + Intronic
1170497861 20:16944292-16944314 AGGCTACTATAACAAATTGCAGG - Intergenic
1173014215 20:39210173-39210195 TTGCCACTATCATCAATGGGAGG - Intergenic
1175345473 20:58270179-58270201 TTCCTGCTATATCAAATCGGGGG - Intergenic
1176725629 21:10430194-10430216 GTGCTACTATATCTAGTGGGTGG - Intergenic
1181292309 22:21805489-21805511 TAACTACTATAACAAATTGGTGG - Intronic
1182033865 22:27182130-27182152 TAGCGACTATAAAAAGTGGGTGG + Intergenic
951344217 3:21526630-21526652 CTGCTGCTATAACAGATAGGAGG + Intronic
953893949 3:46779852-46779874 TTGCTACTATATAACAAGGGTGG + Intronic
955536500 3:59929175-59929197 TTGTTGCTATAACAAATTGCTGG - Intronic
955690425 3:61585410-61585432 TTGGTACTATAGCCATTGGGTGG + Intronic
961028616 3:123583601-123583623 TTGCTAGTATTAGAAATGGTAGG - Intronic
961793971 3:129396324-129396346 TTGCTCCTATAACCAATGCTGGG + Intergenic
963282915 3:143404426-143404448 ATGCTAATTTATCAAATGGGAGG - Intronic
966096887 3:176214162-176214184 TTTATATTATACCAAATGGGGGG - Intergenic
971209569 4:24602721-24602743 GTGTTACTAGAACAAAAGGGAGG + Intergenic
971610527 4:28719639-28719661 TTACCACTATAACAAATTGAGGG - Intergenic
973882519 4:55288335-55288357 TTACTACCATAATAAATTGGAGG + Intergenic
976973739 4:91140966-91140988 TGGGTACTATAAAAACTGGGAGG - Intronic
980058450 4:128102169-128102191 TTCCTACTATTACAAATGGTAGG - Intronic
984198081 4:176684249-176684271 TTGCTGATATAACAAATGGAAGG + Intronic
990279929 5:54239371-54239393 TAGCTACACTAACAATTGGGGGG - Intronic
991175965 5:63688013-63688035 GTGTTACTAGAACAAAAGGGAGG - Intergenic
991656292 5:68907064-68907086 TTTCCACTGTAAAAAATGGGAGG + Intergenic
993425584 5:87760348-87760370 CTGCTAATATAAAAAATGGGTGG + Intergenic
994647386 5:102487643-102487665 TGGCTAATATACCAAGTGGGTGG + Intronic
995277503 5:110293880-110293902 TTGCTACTTTATAGAATGGGTGG - Intronic
999828330 5:155295554-155295576 TTCCTCATCTAACAAATGGGGGG + Intergenic
1002096588 5:176834878-176834900 TTGCTCCTCTAAGAACTGGGAGG - Intronic
1008258378 6:49333282-49333304 TTGCTAATCTCAAAAATGGGGGG + Intergenic
1008264149 6:49403032-49403054 TAGCTACTATAACAAGTGCCAGG + Intergenic
1009588562 6:65637705-65637727 TTGCAACTCTAACAAGTGTGCGG + Intronic
1010043040 6:71409545-71409567 TTGCTATTTTAAAAAATGTGTGG - Intergenic
1012902970 6:105029209-105029231 GTGTTTCTATAATAAATGGGAGG + Intronic
1014393730 6:120897496-120897518 TTGATACTAAAAGAAATAGGTGG - Intergenic
1014481155 6:121938225-121938247 TTGCTATGCTAACAAATGTGAGG + Intergenic
1014762203 6:125368886-125368908 TTGCTACTATTTCAACTAGGAGG + Intergenic
1015208961 6:130673995-130674017 TTGCTAGCTTAACAAATGTGAGG - Intergenic
1018596244 6:165484165-165484187 TTCCAACTATAAGAAATAGGAGG - Intronic
1021634965 7:22682961-22682983 TGGCTATTATAATAAAGGGGAGG - Intergenic
1026263862 7:68779218-68779240 TTGCAATTATAACAAATGAATGG + Intergenic
1027613248 7:80389208-80389230 TAGCTAATATAAAAAATGGAAGG - Intronic
1028090776 7:86698120-86698142 TTGCTGCTATAGAAAATGGACGG - Intronic
1031241397 7:119246498-119246520 ATGCTGCAATAAAAAATGGGAGG + Intergenic
1031738724 7:125400204-125400226 TAGCTAAAATAACAAATGGCAGG + Intergenic
1031864100 7:127018569-127018591 TTGCTACCTTAAAAAATGTGGGG - Intronic
1036081857 8:5565938-5565960 TTGCTACTGTGAAAAAGGGGAGG - Intergenic
1037047707 8:14329091-14329113 TTGCTACTATAACAAAATACTGG - Intronic
1041649894 8:60291763-60291785 TAGCTATTATAAGAAATGGTTGG + Intergenic
1045409908 8:101906483-101906505 TTGACACAAAAACAAATGGGTGG + Intronic
1046752634 8:117941378-117941400 TTGCTACTATAACATATGGAGGG + Intronic
1046755258 8:117966452-117966474 TTGCTACTAAAGAAACTGGGAGG + Intronic
1047462778 8:125084344-125084366 TTGCTAATATATCAAATAGTAGG - Intronic
1052012840 9:23431533-23431555 TTGCTACTTTTAGAAAAGGGAGG - Intergenic
1055043910 9:71905659-71905681 TGGCTACTATAATGAATGAGGGG + Intronic
1055353773 9:75416775-75416797 TTGCTCCTCTAATAAATAGGTGG - Intergenic
1055765729 9:79661876-79661898 TTCCAACTATCACAAATGAGCGG - Intronic
1056107256 9:83359564-83359586 TCTCTACTACAACAACTGGGTGG - Intronic
1062090188 9:134672214-134672236 TTGCTTTTATAACAAATGAATGG - Intronic
1185874355 X:3690157-3690179 TTGCTGCTATAACCAGTGGGTGG + Intronic
1186210812 X:7248909-7248931 TTGCTCCCATTAAAAATGGGTGG - Intronic
1186588831 X:10906326-10906348 TTGCTGCTATGACAAATCAGGGG + Intergenic
1189528645 X:41855149-41855171 TTGTTACTAAAAGAAAAGGGGGG - Intronic
1202360400 Y:24103677-24103699 TTGCTACCATAAAAAAAGGGGGG - Intergenic
1202510378 Y:25566441-25566463 TTGCTACCATAAAAAAAGGGGGG + Intergenic