ID: 947508260

View in Genome Browser
Species Human (GRCh38)
Location 2:230726804-230726826
Sequence CCTTCCCTACAGAAGCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947508260 Original CRISPR CCTTCCCTACAGAAGCTGAA AGG Intronic
904794022 1:33045325-33045347 GCCACCCTGCAGAAGCTGAAAGG + Intronic
906626575 1:47330818-47330840 CCTCCTCCCCAGAAGCTGAAGGG + Intergenic
912285923 1:108369043-108369065 CCCACCCTGCAGAAGATGAAAGG - Intergenic
912450540 1:109765151-109765173 CTATCCCAAAAGAAGCTGAAGGG - Intronic
918191830 1:182183164-182183186 CCCTCCCTACAGCAAGTGAAAGG + Intergenic
918303287 1:183223484-183223506 CCTTCCCTCAAGCAGCTGACAGG + Intronic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1066757193 10:38722878-38722900 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1068805007 10:61185614-61185636 CCTTCCCTATTAAATCTGAAAGG + Intergenic
1070359360 10:75672327-75672349 ACTTCCCTACAAAATCTGAAAGG - Intronic
1071473185 10:86001883-86001905 CCTTCCCTAGAGACTTTGAAGGG - Intronic
1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG + Intronic
1077909869 11:6564321-6564343 CTTCCACTCCAGAAGCTGAAGGG + Exonic
1079526232 11:21391941-21391963 TCTTCCCTACAAGATCTGAATGG - Intronic
1081622551 11:44627453-44627475 CTTTCCCTCCAGAAGCCCAAGGG - Intergenic
1081873850 11:46395907-46395929 TCTTCCCTACAGTGGCCGAAAGG - Intergenic
1082807361 11:57459517-57459539 ACTTCCCTACAAAGGCTGCAGGG - Intergenic
1083419384 11:62544723-62544745 ACTTCCTTTCAGAAGCTGAATGG - Intronic
1084044778 11:66562245-66562267 CACCCCCTACAGAAGCAGAATGG + Exonic
1086911671 11:92479573-92479595 CCTTATCTACAGAGGCAGAATGG - Intronic
1090836929 11:130460888-130460910 CATTGGCTACAGAAGCTCAAGGG - Intronic
1092197387 12:6557477-6557499 GCCTCCTTCCAGAAGCTGAATGG - Exonic
1092265058 12:6974467-6974489 CCTTCCATACAGAGGCTCAAAGG - Intronic
1093533272 12:20192771-20192793 CCTGACCTAAAGAAGCTGACAGG - Intergenic
1102623236 12:114213711-114213733 CTTGCTCTACAGAAACTGAATGG - Intergenic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1102783045 12:115582168-115582190 CCTTCCCTACACAGGTTGAGAGG - Intergenic
1102960996 12:117093171-117093193 CCTGCCCTCCAGAAGCTCAGGGG - Intronic
1103524856 12:121560882-121560904 CCATCCCTAGAGCAGCTGACAGG + Intronic
1104575648 12:129963719-129963741 CCTTCCCTGCAGGAGCCGAGAGG + Intergenic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1107354526 13:39552746-39552768 CCTTCACTTCAGAAGCTTCATGG - Intronic
1108424794 13:50288992-50289014 TCTTCACTACAGTAGCTCAAAGG - Intronic
1109281480 13:60361429-60361451 CCTGACCTACAGAAACTGAAGGG + Intergenic
1110015531 13:70396511-70396533 CCCTCCCTAAAGAAGCTGTCAGG - Intergenic
1112508097 13:99987554-99987576 CCTTCCCCGCAGGAGCTGATCGG + Intergenic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114484500 14:23054887-23054909 CCTTCCCTGCTGCTGCTGAATGG - Intronic
1114757037 14:25270896-25270918 TCTTCCCTCCAGAAGATGCAGGG - Intergenic
1115036749 14:28866753-28866775 CCTGACCTACAGAACCTCAAAGG - Intergenic
1115099844 14:29685363-29685385 GCTTCCCTGCAGATGATGAAAGG - Intronic
1116501305 14:45626158-45626180 CCTTCATTACAGAAGATCAAAGG + Intergenic
1118625077 14:67651369-67651391 CCTTCCCTATAGAAGTTCAATGG + Exonic
1119455729 14:74753984-74754006 CTTTCCCTATAGAAGCTGAAGGG + Intergenic
1119495745 14:75077307-75077329 CTTTCCCAACAGAACCTGAGAGG - Intronic
1119579036 14:75757814-75757836 TTTCCCCTACAGAAGCAGAAAGG - Intronic
1119858370 14:77918135-77918157 CCATCCCTACTGAAGTTGACAGG - Intronic
1120686033 14:87538902-87538924 CCTTCACTACAGAACTTTAAAGG - Intergenic
1120952133 14:90051185-90051207 CGTTCCCAACAGGAGATGAATGG - Intergenic
1120991889 14:90384071-90384093 CCTTCCCCACAGAAGCAATAAGG - Intergenic
1121594875 14:95154514-95154536 CCTTCCTTGGAAAAGCTGAATGG - Intronic
1124628357 15:31323255-31323277 CCTTCACGACATATGCTGAAAGG - Intergenic
1124781561 15:32641363-32641385 TCTTCCCTCTTGAAGCTGAAAGG + Intergenic
1125336902 15:38635695-38635717 TCTTCCCCACAGAGGCTGTATGG + Intergenic
1127981360 15:64037657-64037679 CTGTCCCTTCAGAAGCTGAGTGG + Intronic
1128116580 15:65111143-65111165 CCTTCCATACAGAATCAGGAAGG + Intronic
1131505298 15:93012812-93012834 CCTTCCATACAAAAGCTGGAAGG - Intronic
1131537761 15:93251934-93251956 CCTTCCCTACCGAAGTTAATAGG - Intergenic
1133470971 16:6075056-6075078 CTTTCACTAGAGAAGCTGGATGG + Intronic
1134336663 16:13305966-13305988 CCTGCCCTCCAGAAGCTCATGGG + Intergenic
1136720335 16:32314847-32314869 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1136725388 16:32353239-32353261 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1136838712 16:33521123-33521145 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1136843722 16:33559297-33559319 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1138134478 16:54509692-54509714 TCTTCTCTTCAGAGGCTGAAGGG + Intergenic
1140324432 16:73987849-73987871 CCCTCCCCACAGAACCTGTAAGG - Intergenic
1140696388 16:77538490-77538512 CCCTCCATACAGTAGGTGAAGGG - Intergenic
1141696953 16:85624686-85624708 CCCAGCCTACAGAGGCTGAACGG - Intronic
1203001043 16_KI270728v1_random:164515-164537 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1203006096 16_KI270728v1_random:202922-202944 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1203132645 16_KI270728v1_random:1700919-1700941 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1203148877 16_KI270728v1_random:1821409-1821431 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1203153887 16_KI270728v1_random:1859595-1859617 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1142671392 17:1488919-1488941 CCTGGCCTATAGGAGCTGAAGGG - Intronic
1144404285 17:14937581-14937603 CCTTCTGTACATAGGCTGAAGGG + Intergenic
1145071646 17:19814714-19814736 CTTTCTCTACAGAAACTAAAAGG - Intronic
1146952263 17:36915019-36915041 CCTACCCTACAGCTGCTGAGAGG - Intergenic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1150569071 17:66369841-66369863 CCTTCCCTCCACATGCAGAATGG + Intronic
1151830058 17:76544338-76544360 CCTTCCCTTCAGAGGCAGAGTGG - Intronic
1154145076 18:11860430-11860452 CCTTCCCTACAGAGGTCAAAAGG - Intronic
1155358495 18:24977419-24977441 GCATCCCTACAGAAGCTGGGTGG - Intergenic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1157081526 18:44530494-44530516 CCTTCCCCACAGAATTTGAATGG + Intergenic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1159309186 18:66686404-66686426 GCTTCCACACACAAGCTGAAGGG - Intergenic
1159329504 18:66972112-66972134 CCTTGCACACAGAAGCTTAAAGG + Intergenic
1160137624 18:76286046-76286068 CCCTCCCTGCAGAAGCACAAAGG + Intergenic
1160784888 19:895563-895585 CCTCCCCTAGAGACGCTGGAGGG + Intergenic
1163611263 19:18302964-18302986 CCTTCCCCACAGAAGTTCAGAGG + Intergenic
1163899773 19:20091095-20091117 CCTTCCCCACAGGGTCTGAAAGG - Intronic
1165131991 19:33638651-33638673 CCTTTCCGACAGAATTTGAATGG - Intronic
1165705135 19:37970580-37970602 CCCTCTGCACAGAAGCTGAACGG - Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1167410655 19:49341858-49341880 CCTTCCCTGGTGAAGCTGACTGG - Intronic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925038717 2:713518-713540 CCTTTCCTACATAACTTGAAAGG - Intergenic
925554888 2:5120349-5120371 TCCTCCTTACAGAAGCAGAAAGG - Intergenic
925812948 2:7718962-7718984 CCTTCCCATCAGAAGCTAACAGG - Intergenic
925857901 2:8148366-8148388 CCTGACTTACAGAAGCAGAAAGG + Intergenic
926746354 2:16161547-16161569 CCTTCCCTAGAGGCTCTGAAAGG + Intergenic
926935899 2:18086416-18086438 CCTTCACTATAGAAGCTGTAGGG - Intronic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
928645422 2:33347218-33347240 CCTTCCCTAAAAGAGCAGAAGGG + Intronic
932710245 2:74057826-74057848 CTTTTCCTACAGAATTTGAATGG - Intronic
933263316 2:80153759-80153781 TTTTCCCTCCAGAAGCAGAAGGG - Intronic
933978689 2:87532812-87532834 CCTTTTCTACAGGGGCTGAATGG - Intergenic
934320499 2:91967319-91967341 CCACCACTGCAGAAGCTGAAGGG + Intergenic
936315143 2:111417983-111418005 CCTTTTCTACAGGGGCTGAATGG + Intergenic
940588320 2:155685762-155685784 CCTTCCCTTTAAAAGCTAAAGGG - Intergenic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
942938517 2:181588430-181588452 CCTTCTCTTCAAAGGCTGAATGG + Intronic
944155196 2:196600327-196600349 CCTTCCCTAGAGACCATGAAAGG + Intergenic
945172154 2:207008051-207008073 CCTTCCTTTCAGAGGATGAAGGG + Intergenic
945442371 2:209895262-209895284 CCTTGCATACAGAGACTGAATGG - Intronic
945579359 2:211573261-211573283 CATTCCCTCCAGAAGCTCTAGGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
1170539123 20:17370662-17370684 CCTTCCCTACTGAACATGAGTGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171009918 20:21503741-21503763 CTTACCCTACAGAGGCTGATGGG + Intergenic
1176112276 20:63416081-63416103 CCTTCCTTCCAGAAGCCGGAAGG - Intronic
1179031807 21:37727151-37727173 CCCTCCCTCCAAAAGCTCAAAGG - Intronic
1180308744 22:11151378-11151400 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1180547221 22:16513189-16513211 CCACCACTGCAGAAGCTGAAGGG + Intergenic
1180912824 22:19464804-19464826 CCTGCCCCACAGAAGCTGACAGG - Intronic
1181841147 22:25662691-25662713 CCTTCCCTACTGAGGCAGCAAGG - Intronic
1182211945 22:28684146-28684168 CCACCACTGCAGAAGCTGAAGGG - Intergenic
1182695512 22:32196705-32196727 TCTTCCCTGGAGCAGCTGAAAGG - Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184607651 22:45583265-45583287 GATTCCTTAGAGAAGCTGAAGGG + Intronic
1185147234 22:49145222-49145244 CCTTCCCTCCTGTAGCTGCAGGG + Intergenic
952391396 3:32883906-32883928 ACTTCCCTTCTGAAGCTGGAAGG - Intronic
953931130 3:47006246-47006268 CCTTACCTTCAGCAGCTGACAGG - Exonic
956343189 3:68249065-68249087 CCTTCCCTACTGAAGGTAATAGG + Intronic
957828142 3:85477737-85477759 TCATCCCTACAGAAGGTGAGAGG - Intronic
958443653 3:94187934-94187956 GCTTCCCTTCAGTAGATGAATGG - Intergenic
960453816 3:117844647-117844669 TGTTCCTTACAGAAGCAGAAAGG + Intergenic
961044392 3:123698845-123698867 CCTTCCCCTCACAAGCAGAATGG - Intronic
961046375 3:123711515-123711537 CCTGCCTCACAGGAGCTGAAGGG + Intronic
961459424 3:127040816-127040838 CCTTCCTTTCAAAGGCTGAATGG - Intergenic
962295969 3:134187396-134187418 CTTTCCCTTCAGAAACTGAAGGG - Intronic
966119907 3:176509859-176509881 ACTCCCCTACAGAAACAGAATGG - Intergenic
969567937 4:7991200-7991222 CCTTCTCTGCAGATGCTGAGAGG + Intronic
970218078 4:13779866-13779888 CCATCCCAACTGTAGCTGAAAGG - Intergenic
973879865 4:55259261-55259283 CCATCAGTACAGAAGCTGCATGG - Intergenic
978272956 4:106913513-106913535 TCTTCCCTCTAGAATCTGAAGGG - Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979211519 4:118110115-118110137 CCTTGACTAGGGAAGCTGAATGG + Intronic
981148818 4:141357209-141357231 CCCTCCCTAAAGATGCAGAAAGG - Intergenic
981831739 4:149009635-149009657 GCTATGCTACAGAAGCTGAAAGG - Intergenic
982350843 4:154413678-154413700 CCTTCCCTGCAGAAACCCAAGGG + Intronic
982717490 4:158824422-158824444 CCTTGCTTAGAGAAGCTGAGGGG - Intronic
987207218 5:15640226-15640248 CCTTCCCTACAGATCCTCAAAGG - Intronic
988805157 5:34733603-34733625 CCTTCTCTAAAGCACCTGAAGGG + Intronic
990057769 5:51606008-51606030 CTTTGCCTACTGAAGCTGCATGG + Intergenic
992591799 5:78303352-78303374 CCCTCCCTCCAGAAGCTCTAGGG + Intergenic
992604916 5:78445733-78445755 CCTTCCCTCAAGCATCTGAAAGG + Intronic
993305975 5:86275808-86275830 CCCACCCTGCAGAAGATGAAAGG - Intergenic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
995051932 5:107716833-107716855 CCTTCCCTCCAGAAGCACCAGGG - Intergenic
995589081 5:113679827-113679849 ACTCCCTTACAGAAGCTGAGAGG + Intergenic
995715647 5:115079717-115079739 ACTTCCCTACAGAAATAGAATGG - Intergenic
996354612 5:122581831-122581853 CCTTCCAGACAGAAGCTGCTGGG - Intergenic
999960239 5:156747338-156747360 CCTGACCTACAGAAAATGAAAGG - Intronic
1000025225 5:157353007-157353029 CATTCCCTCCAGAAACTGCAGGG - Intronic
1003394755 6:5743413-5743435 CCTTCCTGACAGCAGCTGAAAGG + Intronic
1004498950 6:16191842-16191864 CCTTCTTTACAAAAGCTTAAAGG + Intergenic
1005446214 6:25925793-25925815 CATTTCCCACAGAAGCTAAATGG - Exonic
1007802493 6:44408096-44408118 CCTTCCCTACAGAATGTGAGGGG - Intronic
1009916982 6:70008365-70008387 CAGACCCTACAGAAACTGAAAGG + Intronic
1011346736 6:86378326-86378348 CCTTACCTACAGAATCTGTGGGG + Intergenic
1011832981 6:91395772-91395794 CCTTCACTACAGAAACTGTCCGG + Intergenic
1011868527 6:91862278-91862300 CCATCCCTATAGAAGTTAAAAGG - Intergenic
1012476510 6:99619402-99619424 ACCTCCCTACAAAAGATGAAAGG + Intergenic
1013279526 6:108622639-108622661 CCTTCCCTAGAGGGGCAGAAAGG - Intronic
1013618743 6:111869297-111869319 CCTTCCGTTAAGAAGCTGCAAGG + Intronic
1013631582 6:111991324-111991346 CCTTCCCTACAGAGGTTAATAGG - Intergenic
1016192388 6:141287130-141287152 CCTGCCTTACAAAGGCTGAAAGG - Intergenic
1016947730 6:149549828-149549850 ACTCCCCTACAGAAGCAGAATGG - Intergenic
1019660531 7:2221382-2221404 CGTTCCCTCCAGAAGCAGATAGG + Intronic
1019788001 7:2991500-2991522 CCTTCCCACCAGAAGCTGTTGGG - Intronic
1022400966 7:30036998-30037020 ACTCCCCTAGAGAAGCTGAGTGG + Intronic
1022413016 7:30154024-30154046 CCTTCCCTACTGAGGTTAAAGGG - Intronic
1023514185 7:40984122-40984144 CTTTCATTACAGAGGCTGAAAGG - Intergenic
1027843105 7:83339199-83339221 TCTCCCCATCAGAAGCTGAAGGG + Intergenic
1029221586 7:98994812-98994834 CCTGTCTTTCAGAAGCTGAAAGG + Exonic
1031795635 7:126171366-126171388 CATTACCTAAAGAAGCTCAAGGG + Intergenic
1031844187 7:126784603-126784625 CCTTCTTCACAGAAGCTGAAAGG + Intronic
1032128513 7:129211465-129211487 CCTTCTCTTCAGATTCTGAAGGG + Intronic
1032604132 7:133330685-133330707 CCTACCCAACAGAAGCTGTGAGG - Intronic
1032746068 7:134787539-134787561 CCTGCCCTAGAGAAGATGTAGGG - Intronic
1034499091 7:151438722-151438744 CCTTCACTGGAGAGGCTGAATGG + Intronic
1036412423 8:8514462-8514484 ACTTCCCTACAGTGGCTGAATGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039026815 8:33267615-33267637 CCTTCCCTACAGAGACATAAGGG + Intergenic
1039891480 8:41688584-41688606 ACTTCCCTGCAGAAGAAGAAAGG + Exonic
1041793567 8:61722829-61722851 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1043158037 8:76810625-76810647 TCATCCATACAGAAGCCGAAGGG - Intronic
1045485929 8:102631192-102631214 CCATCATTACAGCAGCTGAATGG - Intergenic
1047986314 8:130238058-130238080 ACTTCCCTGAAGAAGCCGAAAGG + Intronic
1048351987 8:133623846-133623868 CCATTCGTACAGAAGCTGAAGGG - Intergenic
1052938274 9:34111734-34111756 TATTCCCTAAAGAATCTGAATGG - Intronic
1053285631 9:36848046-36848068 CCTTCCCTACTGGAGGTGACAGG + Intronic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056210196 9:84358137-84358159 CCTTCCCTACTGAAGCTAATCGG - Intergenic
1057611972 9:96552775-96552797 CCTTCCGTACATTAGTTGAAAGG - Intronic
1059155914 9:111988171-111988193 CCTTCTCTTCAGAAGCTAGAAGG - Intergenic
1060428343 9:123525593-123525615 CCTGCTCTACAGGAGCTAAAGGG + Intronic
1061747948 9:132753722-132753744 CCTTCCCTAGAGAACATGGAGGG - Intronic
1062410415 9:136421341-136421363 CCTTCCCTAAAAAACCTGAAGGG + Intronic
1062414540 9:136441545-136441567 CTTTCCATCCAGAATCTGAAAGG + Exonic
1187697639 X:21937804-21937826 CCTTCCCTACTGAAGTTAATAGG + Intergenic
1192032199 X:67525578-67525600 CCTGCTCTTCAGAAGCTCAAAGG + Intergenic
1193455224 X:81724014-81724036 ACTTCCCAGCAGCAGCTGAATGG + Intergenic
1202231445 Y:22663259-22663281 GCTTCCATGGAGAAGCTGAAAGG - Intergenic
1202311713 Y:23532906-23532928 GCTTCCATGGAGAAGCTGAAAGG + Intergenic
1202559089 Y:26137688-26137710 GCTTCCATGGAGAAGCTGAAAGG - Intergenic