ID: 947510564

View in Genome Browser
Species Human (GRCh38)
Location 2:230749554-230749576
Sequence CTGCATGTATAGATAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947510561_947510564 18 Left 947510561 2:230749513-230749535 CCATTATTAACCTTTGCTATTTT 0: 1
1: 0
2: 3
3: 49
4: 536
Right 947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 220
947510562_947510564 8 Left 947510562 2:230749523-230749545 CCTTTGCTATTTTTTCTCTTAGC 0: 1
1: 0
2: 3
3: 52
4: 599
Right 947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 220
947510560_947510564 19 Left 947510560 2:230749512-230749534 CCCATTATTAACCTTTGCTATTT 0: 1
1: 0
2: 1
3: 38
4: 422
Right 947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG 0: 1
1: 0
2: 1
3: 20
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947510564 Original CRISPR CTGCATGTATAGATAAAGAT GGG Intronic
901304039 1:8219494-8219516 ATGTATCTATAGATATAGATGGG + Intergenic
903640614 1:24857411-24857433 CTGCATGTGTGGAGACAGATAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
906941051 1:50255731-50255753 CTGGATCTATAAATAAACATGGG - Intergenic
908350350 1:63280789-63280811 CTGCAGTTATAGGTAAAGTTGGG - Intergenic
909160687 1:72145728-72145750 ATGAAGGTAGAGATAAAGATTGG - Intronic
909490892 1:76225282-76225304 CTGCATCTATATATAGAAATGGG - Intronic
910404837 1:86876604-86876626 CTTTATGTAAAGATATAGATTGG + Intronic
910936596 1:92487816-92487838 CTGCATTTATATATAAAGAAGGG - Intergenic
911403186 1:97402189-97402211 TTGCATCTATAGATCAAGCTGGG + Intronic
911644583 1:100324697-100324719 GTGCATGTATACATATATATTGG + Intergenic
912134827 1:106648322-106648344 CTTCATGTAAACAAAAAGATTGG - Intergenic
912325586 1:108757144-108757166 TTGTATGTATATATGAAGATGGG + Intronic
914007199 1:143742763-143742785 CTGCATATATAGGTAAAATTAGG - Intergenic
914646016 1:149653257-149653279 CTGCATATATAGGTAAAATTAGG - Intergenic
918795446 1:188888783-188888805 CTGCATGATTAGATAAAGTAGGG - Intergenic
918953320 1:191171022-191171044 ATGCATGTATATATACACATAGG - Intergenic
920689280 1:208133507-208133529 TTGCATATGTAGATATAGATAGG - Intronic
923703600 1:236324013-236324035 CTCCATGAATAGACATAGATTGG + Intergenic
923842002 1:237683090-237683112 TTGTATGTATAGAAAAATATTGG + Intronic
1063064260 10:2592347-2592369 CTGTGTGTATAACTAAAGATGGG + Intergenic
1066496682 10:35948941-35948963 CCGCCTGTAAACATAAAGATCGG - Intergenic
1067382912 10:45791675-45791697 TAGCATGTATACATAAAGTTAGG - Intronic
1069154287 10:65006192-65006214 CTGAATCTATAGATCAAGTTGGG + Intergenic
1069196594 10:65558423-65558445 TTGTATGTATAAATAAAAATTGG - Intergenic
1071321855 10:84468313-84468335 CTGATTTTATATATAAAGATAGG - Intronic
1072727905 10:97825832-97825854 CCTCATTTATAGACAAAGATAGG + Intergenic
1073183664 10:101602235-101602257 CTGCATGTAAAGCAAGAGATGGG - Intronic
1074617375 10:115082961-115082983 CTGCATGTTTAAAAGAAGATCGG + Intergenic
1074810534 10:117100582-117100604 CTGCATGTAATAATACAGATTGG + Intronic
1078755625 11:14206074-14206096 TTGCAAGTATATATAAAAATAGG - Intronic
1079214379 11:18494949-18494971 CTGAATATTTAGATAAAGAAAGG - Intronic
1079293486 11:19210238-19210260 CTCCATCTAAACATAAAGATTGG + Intronic
1081075636 11:38669345-38669367 CTGCATGTTTAAGTAAATATAGG - Intergenic
1082246878 11:49933888-49933910 ATGAATGTATAGATAAAGTTGGG - Intergenic
1086591436 11:88519599-88519621 CTGCTTTTATAGGTAAACATGGG + Intronic
1088171799 11:107006452-107006474 GTGCATGTATATATACAAATGGG + Intronic
1088229996 11:107663849-107663871 CTGCATGCATAAATGAAAATGGG - Intronic
1090138852 11:124231125-124231147 TTGAATGTATAGATGAATATGGG + Intergenic
1090841476 11:130492062-130492084 CTGGATCTATAGATCAAGTTAGG + Intergenic
1093612525 12:21179830-21179852 CTGTATCTACATATAAAGATGGG - Intronic
1093827970 12:23718396-23718418 CTGTATGCAAAGATTAAGATAGG - Intronic
1096932709 12:55231930-55231952 TTGAATCTATAGATAAAGTTGGG - Intergenic
1101279157 12:103233390-103233412 CTGAATCTATAGATCAAGTTGGG + Intergenic
1101644829 12:106621599-106621621 CTGCATGTATAGCTTAGGAGTGG + Intronic
1103654846 12:122462481-122462503 TAGGATGTTTAGATAAAGATAGG - Intergenic
1105653579 13:22407992-22408014 CTGCATGTAATGATAAAACTGGG - Intergenic
1108113243 13:47100410-47100432 TTGCATGTATAAACAAAGACTGG + Intergenic
1108888310 13:55219644-55219666 CTGCATTTATAGAAAAAGAAAGG + Intergenic
1109608088 13:64725360-64725382 ATGCATGTATGGATATATATAGG - Intergenic
1109684748 13:65803399-65803421 CTGTATTTATTCATAAAGATGGG - Intergenic
1109955402 13:69558908-69558930 ATGTATGTATAGAAAAACATTGG - Intergenic
1111162358 13:84412164-84412186 CTACAGGTATAGATAACAATTGG + Intergenic
1112439161 13:99413262-99413284 GTGGGTGGATAGATAAAGATAGG + Intergenic
1113048416 13:106182019-106182041 CTGTATGTATACATACATATGGG - Intergenic
1114533422 14:23409142-23409164 CTGCATGTGTGGCTGAAGATGGG - Intergenic
1114908730 14:27164627-27164649 TTGAATGTATAGATTAAGTTGGG + Intergenic
1115785377 14:36819912-36819934 CTGCATATTCATATAAAGATAGG - Intronic
1117105895 14:52396472-52396494 ATACATGTAGACATAAAGATTGG - Intergenic
1117765374 14:59076319-59076341 CTCCATATATAGATGCAGATGGG - Intergenic
1118388205 14:65274348-65274370 TTGCATCTCTAGATAGAGATTGG - Intergenic
1119843233 14:77808951-77808973 CTGCTTTTATGGATAATGATTGG - Intronic
1119848148 14:77846339-77846361 CTGCATGGCTGGATTAAGATGGG - Intronic
1120761510 14:88289592-88289614 CTGTGTGTGTAGCTAAAGATTGG - Intronic
1121093709 14:91201231-91201253 CTGCACGTATACATCTAGATGGG - Intronic
1123878011 15:24643709-24643731 CTATATATATAGATATAGATAGG - Intergenic
1124599624 15:31122752-31122774 TTGCATCTATAGATCAAGTTGGG - Intronic
1125151002 15:36532229-36532251 CTGCAGGTATGCATAAAGACAGG - Intergenic
1125330587 15:38578356-38578378 CTGCAAGTATGGATCAAGATTGG + Intergenic
1126574411 15:50183012-50183034 CTGTAGGTATAGAAAAAGGTTGG + Intronic
1128539097 15:68512539-68512561 TTGCATGGATAGATAATGATGGG - Intergenic
1136632071 16:31494846-31494868 CTGCATTTTTTGGTAAAGATGGG + Intronic
1136714615 16:32268534-32268556 CTGCATTTATAGATAATTTTAGG + Intergenic
1136753292 16:32661213-32661235 CTGCATTTATAGATAATTTTAGG - Intergenic
1136814821 16:33209152-33209174 CTGCATTTATAGATAATTTTAGG + Intronic
1136821297 16:33319232-33319254 CTGCATTTATAGATAATTTTAGG + Intergenic
1136827860 16:33375771-33375793 CTGCATTTATAGATAATTTTAGG + Intergenic
1136832926 16:33474542-33474564 CTGCATTTATAGATAATTTTAGG + Intergenic
1137014017 16:35355262-35355284 CAGCATGTATAAATATAAATAGG - Intergenic
1141356181 16:83349037-83349059 CTGCACATACAGATAAATATGGG - Intronic
1202993398 16_KI270728v1_random:32126-32148 CTGCATTTATAGATAATTTTAGG + Intergenic
1203055436 16_KI270728v1_random:921235-921257 CTGCATTTATAGATAATTTTAGG - Intergenic
1142943295 17:3401527-3401549 CTGCCTTGATAGATATAGATAGG + Intergenic
1148964009 17:51419219-51419241 GTACATGTGTAGAAAAAGATCGG - Intergenic
1149853613 17:60058180-60058202 CTGAATCTATAGATCAAGTTGGG + Intronic
1150899332 17:69253668-69253690 CTACATGGAAAGAAAAAGATGGG + Intronic
1152191078 17:78888089-78888111 ATACATATATGGATAAAGATAGG + Intronic
1153279338 18:3399374-3399396 ATGCAGCTATAGATATAGATAGG - Intergenic
1155609608 18:27650590-27650612 CTACATGTCTAGATATATATTGG - Intergenic
1155665338 18:28300838-28300860 CAGAATCTATAGATCAAGATGGG - Intergenic
1156009943 18:32485432-32485454 AGGCAAATATAGATAAAGATGGG - Intergenic
1156651541 18:39232605-39232627 CTGCATTTATAAAGAAAGAAAGG - Intergenic
1156986885 18:43359647-43359669 CTGGTAGTATAGTTAAAGATGGG - Intergenic
1157031487 18:43914846-43914868 CTTCATTTATAGACAAAGAGTGG + Intergenic
1157057167 18:44244071-44244093 CTGCATGTACAGAATAAGATTGG - Intergenic
1157554426 18:48603698-48603720 ATGGATGAATAGATATAGATGGG + Intronic
1158701036 18:59747007-59747029 TTGAATCTATAGATGAAGATAGG + Intergenic
925565364 2:5247968-5247990 CTGAATCTATAGATCAAGTTGGG - Intergenic
925680007 2:6410563-6410585 CTGACTGTATCAATAAAGATAGG + Intergenic
928812939 2:35251046-35251068 TTGTATGCATAGATAAAGTTAGG + Intergenic
929196470 2:39190120-39190142 CTGCATGTTTAGAAAAGGATTGG + Intronic
930298971 2:49591598-49591620 GTGTATGTATAAATAAATATAGG - Intergenic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
932743368 2:74309589-74309611 TTGCATCTATAGATCAAGTTGGG + Intronic
933581924 2:84136936-84136958 CTGCATGTGTAATTAAAGAGAGG - Intergenic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935486960 2:103668648-103668670 CTGCATGTATATAGGTAGATAGG + Intergenic
936268095 2:111026342-111026364 TTGCATCTATAGATCAATATGGG + Intronic
937531386 2:122831661-122831683 ATGCATGTGTGGATAAAGAAGGG + Intergenic
938198113 2:129350091-129350113 TTGAATGTATAGATCAAGTTGGG + Intergenic
939276027 2:139997024-139997046 CTGCATGTATTGATAAGTATGGG - Intergenic
939281663 2:140073498-140073520 ATGGATGAGTAGATAAAGATGGG - Intergenic
939419878 2:141952727-141952749 ATCCATGTATAGATAAGGAAGGG - Intronic
940357268 2:152757399-152757421 ATGCATGTATAGATATAGATTGG + Intronic
942211047 2:173670644-173670666 ATGTATGTTTAGATAAAGATAGG - Intergenic
943839206 2:192556438-192556460 CTACATCTAAACATAAAGATGGG - Intergenic
945341420 2:208660471-208660493 ATGCATGTATAGATCAATTTGGG + Intronic
945662812 2:212707249-212707271 CTGCAGATATAGATTATGATAGG - Intergenic
946003221 2:216500349-216500371 CTGCAAGTTTTGATAAAAATAGG + Intronic
946676997 2:222170869-222170891 ATGCATTTATAGAAGAAGATGGG - Intergenic
947135198 2:226970445-226970467 CTTCATGTACAGATAAAACTTGG - Intronic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
947798644 2:232911571-232911593 TGGAATGTATAGATAAATATGGG + Intronic
1169724582 20:8715114-8715136 CAGCATGTAGAGATAACTATTGG + Intronic
1169863781 20:10178335-10178357 TTGCATGTTTAGATAAATAATGG - Intergenic
1169895403 20:10500447-10500469 CTTCATGTGTGGAAAAAGATGGG + Intronic
1169944625 20:10975458-10975480 CAGCATAAATAGATTAAGATAGG - Intergenic
1170872869 20:20223721-20223743 CTGTGTGTATAGAAAAAAATTGG - Intronic
1171376161 20:24695445-24695467 CTGCATGTAAAGCTAATGACAGG + Intergenic
1173043972 20:39491867-39491889 CAGCATGTAGAGACAGAGATTGG - Intergenic
1173870812 20:46340960-46340982 CTGCTTATATAGACACAGATGGG - Intergenic
950321764 3:12061944-12061966 CTGCATCTACAGATCAAGTTGGG - Intronic
951190236 3:19760099-19760121 ATGCATTTATACATAAAGATAGG + Intergenic
951533070 3:23716351-23716373 CTGAATCTATAGATCAAGCTGGG + Intergenic
951754824 3:26078704-26078726 CTGCCTGTGCAGATAAACATAGG + Intergenic
951919036 3:27833104-27833126 ATGCATGTCTAGATAATGATTGG + Intergenic
952218232 3:31298946-31298968 CTGTATGTAATGAAAAAGATTGG - Intergenic
952407112 3:33014648-33014670 CTGCTAGAATAGAGAAAGATGGG + Intronic
953737915 3:45512100-45512122 CTGGATTCAAAGATAAAGATAGG - Intronic
955396099 3:58558776-58558798 CTATGTTTATAGATAAAGATTGG + Intergenic
957346181 3:78964116-78964138 CACCATGTAAAGATAAAGACAGG - Intronic
957820130 3:85361951-85361973 CTGAATGTGTTGATAAAGAGTGG + Intronic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
958581826 3:96035889-96035911 TTGCATCTATAGATCAAGTTGGG + Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
959821445 3:110739989-110740011 CTTCATGTCAAGATAATGATGGG + Intergenic
961596715 3:128023467-128023489 CTGCTTGTTTAAATAGAGATGGG + Intergenic
963561296 3:146869196-146869218 GTGTATGTAGACATAAAGATGGG - Intergenic
967244533 3:187471936-187471958 CTGCATGTACACATCCAGATGGG - Intergenic
967358987 3:188608736-188608758 CTGCATCTATAGATAACTTTGGG + Intronic
971223425 4:24730108-24730130 CTGCATGCAAAGAGAAAGCTCGG - Intergenic
972103495 4:35451974-35451996 CTGGGTCTATACATAAAGATGGG - Intergenic
972550609 4:40129590-40129612 CTGCATGTGAAGGTAAAGGTGGG - Intronic
974840521 4:67294504-67294526 CTGGATTTAAAGATAAAGAAAGG - Intergenic
975630398 4:76395953-76395975 CTGCATTTATAGTTAATAATTGG - Intronic
975698239 4:77035896-77035918 CTACATGTAGAGAGAAAGCTGGG - Exonic
977232856 4:94472694-94472716 CGGCATTTATAGATAAAGTTGGG + Intronic
978129397 4:105176690-105176712 CTGAATCTATAGATCAAGTTGGG - Intronic
978262487 4:106777357-106777379 CTGTATTTATAGATAAATTTGGG - Intergenic
978450381 4:108826998-108827020 CTGAATTTATAGATAATGAGTGG + Intronic
978475267 4:109121025-109121047 TTGAATCTATAGATTAAGATGGG - Intronic
978662303 4:111141800-111141822 CTGAATGAATGGATAAAGAAAGG - Intergenic
980071232 4:128244380-128244402 CTGCATGTGTATTTAAAGAAAGG - Intergenic
980476542 4:133324847-133324869 CTCCATGAATATATAAAGGTGGG + Intergenic
980756361 4:137169075-137169097 CTACATGTATATATACATATAGG + Intergenic
980756362 4:137169113-137169135 CTACATGTATATATACATATAGG - Intergenic
981610461 4:146588758-146588780 CTGCATGTATAGGTAAGGCTTGG - Intergenic
982648928 4:158062377-158062399 TTGCAGGCATAGATAAAGATGGG - Intergenic
987916712 5:24224768-24224790 CTCCATTTAAAGACAAAGATTGG - Intergenic
988753685 5:34221232-34221254 ATTTATGTATAGATAAATATAGG - Intergenic
990365660 5:55067549-55067571 CTGGATGAATAGATAAATCTGGG - Intergenic
990756975 5:59083573-59083595 ATATATGTATATATAAAGATTGG - Intronic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
992400404 5:76405650-76405672 CTGCATGAATAGGTAATGTTAGG - Intronic
992526908 5:77620511-77620533 CTTCATGCATACATAAAGAGAGG + Intronic
993172856 5:84442478-84442500 TTGAATTTATAGATAAAGATGGG - Intergenic
993235434 5:85302391-85302413 ATACATGTATAGGTAAATATAGG - Intergenic
993325377 5:86528191-86528213 ATGCATGTCTAGACAAATATTGG - Intergenic
995147419 5:108802263-108802285 TTGAATGTATAGATAAATTTGGG + Intronic
995262027 5:110115338-110115360 CTGAATGTATATATTAATATAGG - Intergenic
995412644 5:111876055-111876077 CTGCCTGCATAATTAAAGATGGG - Intronic
996843769 5:127877369-127877391 CTACCTGTATAGAAAAACATGGG + Intergenic
1000238745 5:159389015-159389037 CTGAATCTATAGATCAAGTTGGG + Intergenic
1000307429 5:160007894-160007916 ATGTATATATAGATAGAGATGGG + Intergenic
1003375838 6:5576721-5576743 CTGAATGAATACATAAAGTTGGG - Intronic
1004435349 6:15587321-15587343 TTGCATGTATAGATCAATTTGGG - Intronic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1004825068 6:19411074-19411096 CTGTATGTATAGATAACAAAAGG + Intergenic
1005230459 6:23696045-23696067 GTACATTAATAGATAAAGATGGG - Intergenic
1007015501 6:38462698-38462720 CTGAATCTATGGATAAATATGGG + Intronic
1007613255 6:43164361-43164383 CTGCATATATATATATATATTGG + Intergenic
1007909537 6:45499814-45499836 CTGCATGGAGAGTTAAAGACAGG - Intronic
1008950383 6:57151776-57151798 TAGCATGTAAAGAGAAAGATTGG + Intronic
1011420573 6:87167892-87167914 CTGCCTTTATAGGTAAAGAAAGG - Intronic
1012324766 6:97903471-97903493 ATACATGTATAGAGAGAGATAGG + Intergenic
1012455603 6:99400927-99400949 GTCGAAGTATAGATAAAGATAGG - Exonic
1012735630 6:102938009-102938031 CTGAATCTATAGATTAAGTTGGG + Intergenic
1012828450 6:104177268-104177290 GTGCATGTATACATTAAGTTTGG - Intergenic
1014072136 6:117194998-117195020 CTGAATGTACAGAAAAAGAGAGG - Intergenic
1014520132 6:122432816-122432838 CTCCATATATATAGAAAGATCGG + Exonic
1014782058 6:125575694-125575716 GTACATGTGGAGATAAAGATGGG - Intergenic
1016247675 6:142003315-142003337 ATGTATGTATAGATTGAGATAGG + Intergenic
1017518514 6:155180405-155180427 CTGAATGATTAGATAATGATTGG + Intronic
1017728777 6:157296030-157296052 CTTCATGTATAGAGAATCATTGG - Intronic
1019510790 7:1416286-1416308 CTGGATGAATAGATAGGGATAGG + Intergenic
1020850328 7:13345202-13345224 CTCCATTTAATGATAAAGATTGG - Intergenic
1022477280 7:30719803-30719825 ATGCATGAATAGATACAGAGAGG - Intronic
1022937614 7:35195678-35195700 CTGAATATATAGATCAAGTTGGG + Intergenic
1027511461 7:79087306-79087328 CTGTCTGCATAGATAAATATTGG + Intronic
1028263766 7:88697096-88697118 TTGCATGAATAAATAAAGTTTGG + Intergenic
1030281798 7:107783714-107783736 CTTCATGTATGGATAACTATTGG - Intronic
1032999091 7:137483152-137483174 CTCCATGAATAGTTACAGATAGG + Intronic
1034142161 7:148830843-148830865 CAGCAGTTATAGATAAAGACTGG + Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1037598283 8:20372890-20372912 ATGTATATATAGATATAGATAGG + Intergenic
1039624428 8:39032995-39033017 TTGAATGTATAGATCAAGTTGGG + Intronic
1042375152 8:68041807-68041829 TGGCAGGCATAGATAAAGATGGG - Intronic
1042592857 8:70414531-70414553 AAACATGTATAGATGAAGATGGG - Intergenic
1044403695 8:91801492-91801514 CTGCATTTAGAGACAAAGGTAGG - Intergenic
1046640406 8:116723314-116723336 GTGCATGTATAGAGAAACAGAGG + Intronic
1048682510 8:136859760-136859782 CTGAATCTATAGATTAAGTTGGG + Intergenic
1050924241 9:11242592-11242614 CTGAATTTATAGATAGAGTTAGG + Intergenic
1051797910 9:20895382-20895404 TTGAATGTATAGATGAAGTTAGG + Intronic
1051957211 9:22710851-22710873 CTGCATGTACAGAAAAAAATAGG - Intergenic
1057823738 9:98355648-98355670 CTGAATGTATAGATCAAGTTGGG - Intronic
1060573122 9:124661963-124661985 CTGGATGTGTAGTTGAAGATGGG - Intronic
1185754815 X:2644787-2644809 CTACATATAAAGAGAAAGATAGG + Intergenic
1185938547 X:4286484-4286506 TTGTATGTATAAATAAAGACCGG - Intergenic
1186240841 X:7564227-7564249 ATGCATGTATATGTAAATATAGG - Intergenic
1186364365 X:8875678-8875700 GTGCAGGTATAGTTATAGATAGG + Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1190149530 X:47932573-47932595 TTGCATCTATAGATAAAATTAGG + Intronic
1190551778 X:51589871-51589893 CTGAATCTATAGATCAAGTTGGG - Intergenic
1190605430 X:52137717-52137739 TTACATCTATAGATAAAGTTGGG - Intergenic
1192294935 X:69837274-69837296 CTGACTGTAGAGATAAAGAAGGG - Intronic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1193378888 X:80795468-80795490 ATACATGTATAGATATACATAGG - Intronic
1195560785 X:106280971-106280993 CTGGATGTTTAGAGAAATATTGG - Intergenic
1197539440 X:127738579-127738601 TTGAATGTATAGATCAAGTTGGG - Intergenic
1198471989 X:136955731-136955753 CTGCATGGATGGATATGGATTGG - Intergenic
1198802897 X:140465776-140465798 CTGCCAGCATAGATAAAGCTAGG + Intergenic
1201721890 Y:17107672-17107694 GTGTATGTATAAATAAAGACTGG - Intergenic