ID: 947513900

View in Genome Browser
Species Human (GRCh38)
Location 2:230784514-230784536
Sequence CGGGATTCCCTGTGTTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947513895_947513900 -5 Left 947513895 2:230784496-230784518 CCCTAGTACCCTGCCTTGCGGGA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 947513900 2:230784514-230784536 CGGGATTCCCTGTGTTTAAATGG 0: 1
1: 0
2: 0
3: 6
4: 99
947513896_947513900 -6 Left 947513896 2:230784497-230784519 CCTAGTACCCTGCCTTGCGGGAT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 947513900 2:230784514-230784536 CGGGATTCCCTGTGTTTAAATGG 0: 1
1: 0
2: 0
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947513900 Original CRISPR CGGGATTCCCTGTGTTTAAA TGG Intronic
901903449 1:12387527-12387549 CTGTATTCTCTGTGTTCAAAAGG + Intronic
901903456 1:12387637-12387659 CTGTATTCTCTGTGTTCAAAAGG + Intronic
903462927 1:23531560-23531582 CCGGATTCCCTGGGATTGAAGGG + Intergenic
904093471 1:27960514-27960536 CGGGATTCCCTTTCCGTAAAGGG - Intronic
905728668 1:40278015-40278037 AAGGATACCCTGTGTTCAAAGGG + Intronic
912738446 1:112171403-112171425 CTGGATTCCCTGATTCTAAATGG - Intergenic
1064282645 10:13965556-13965578 CTGCAATCCCTGTGTTTAGAAGG + Intronic
1064404542 10:15049556-15049578 CTGAATTACCTGTGTTTTAATGG - Intronic
1067735777 10:48849044-48849066 GGGGATCCCCTGAGTTTAACTGG + Intronic
1067848346 10:49739968-49739990 AGGGATTCCCTGGGATTCAAAGG + Intronic
1072325223 10:94291566-94291588 TGGGATTCCCTATCTGTAAAAGG + Intronic
1072447658 10:95513543-95513565 CTGGATTCCTTGTACTTAAATGG + Intronic
1074350593 10:112733090-112733112 TGGGATTATCTGGGTTTAAAAGG + Intronic
1079702585 11:23567253-23567275 CGTGATTCCCTGTGTCTCAAAGG + Intergenic
1088675830 11:112192256-112192278 CAGGATTTCCTTTGTTTTAAAGG + Intronic
1097347896 12:58515215-58515237 TGGCATTCCCTGTGTGTTAATGG + Intergenic
1097872790 12:64615078-64615100 GTGGATTCGCTGTGTTTCAAAGG + Intronic
1100358312 12:93852678-93852700 AGGGATTTCCTGTGTTTGTATGG + Intronic
1102033638 12:109758864-109758886 GGGTATTACCTGTGTTGAAATGG - Intronic
1104421830 12:128642366-128642388 AGGTATTTCCTGTTTTTAAAGGG + Intronic
1113250729 13:108449598-108449620 AAGGGTTCCCTGTGTTTCAAAGG + Intergenic
1115449320 14:33527920-33527942 CTGGATTCCTTGTGTTGAAATGG - Intronic
1119292114 14:73503688-73503710 GGGGATTTCCTGTGCTTACAAGG - Intronic
1121241427 14:92432913-92432935 TGTCATTCCCTGTGTTTAAGGGG + Intronic
1122894205 14:104747889-104747911 TAGGATTCCCTGTCTTTGAAAGG - Intergenic
1124012954 15:25853409-25853431 GGGGAAGCCCTGTCTTTAAAAGG + Intronic
1124663661 15:31571967-31571989 GGGGAATCCATGTGTTTTAAGGG - Intronic
1124902106 15:33833819-33833841 CAGGATTCCCAAGGTTTAAAAGG - Intronic
1125506592 15:40271155-40271177 AGGGATTACGTGTTTTTAAAGGG - Intronic
1125521966 15:40353218-40353240 AGGGAATACCTGTGTTCAAAAGG - Exonic
1129762100 15:78135321-78135343 CGTGGTTACCAGTGTTTAAAGGG + Intronic
1130973181 15:88751287-88751309 AGGGATTAGCTGTGTCTAAAGGG - Intergenic
1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG + Intronic
1135747521 16:25029851-25029873 CTGGATTCCAGGTGTTTTAAGGG + Intergenic
1146391566 17:32428066-32428088 AGTGAGTCCCTGTGTTAAAAAGG + Intergenic
1150155904 17:62852749-62852771 AGGGATTGACTGTTTTTAAATGG + Intergenic
1152060992 17:78075010-78075032 CTGGCTTCCCTGTGTTTGAAGGG + Intronic
1157717636 18:49899830-49899852 CAGGATGCCCTGTGTGTAGAGGG - Intronic
1158047171 18:53170158-53170180 GTGGCTTCCCTGTGTTTTAATGG - Intronic
1158139789 18:54243349-54243371 CTGGATACCCTTTGTTGAAAGGG + Intergenic
1161176170 19:2843283-2843305 CTGGAGTCCCTGTGTTCAGAAGG - Intronic
1161476298 19:4487614-4487636 TGGAATTGTCTGTGTTTAAATGG + Intronic
1165361540 19:35340003-35340025 CAAGATTCACTGTGTTAAAAGGG - Intronic
1167856703 19:52247788-52247810 CAGGATGCAGTGTGTTTAAAGGG + Intergenic
926362521 2:12103446-12103468 CGTGTTTCCATGTGTTTAGAAGG + Intergenic
937443172 2:121934072-121934094 CTGGATTTTCTGTTTTTAAAAGG - Intergenic
940108732 2:150127149-150127171 TGAGATTCCCTGGGCTTAAAAGG + Intergenic
941706776 2:168667158-168667180 TGGGATTTTCTGTGTTTAACAGG + Intronic
943268428 2:185767611-185767633 CAGGATTTCCTTTGTTTGAAAGG + Intronic
943532450 2:189100222-189100244 AGAAATTCCCTGTGTTTACATGG - Intronic
944635202 2:201669229-201669251 CAAGATTCCCTCTGTCTAAAAGG - Intronic
944924625 2:204451794-204451816 CAATTTTCCCTGTGTTTAAAAGG - Intergenic
946767141 2:223051241-223051263 CGGTAGACCCTGTGTTTAAATGG - Intergenic
947513900 2:230784514-230784536 CGGGATTCCCTGTGTTTAAATGG + Intronic
948553091 2:238787947-238787969 AGAGATGCCCTGTGTTAAAATGG + Intergenic
1172785049 20:37463157-37463179 TGGTATTGCCTGTGGTTAAATGG - Intergenic
1173824787 20:46041230-46041252 CTGGCGTCCGTGTGTTTAAAAGG + Intronic
1174390496 20:50215975-50215997 CTGGTTTCCCCGTGTGTAAATGG + Intergenic
1179451792 21:41473213-41473235 CCGGCATCCTTGTGTTTAAATGG - Intronic
1184217177 22:43075639-43075661 GAGGATTCCTTGGGTTTAAAGGG - Intronic
953582410 3:44168929-44168951 GGGGGTTCCCTGTTTTAAAATGG + Intergenic
957151174 3:76488050-76488072 CGTGACTCCCCGTGTTTATATGG - Intronic
965771197 3:172182640-172182662 TGGAATTCCCTGCGTTTAACAGG - Intronic
971156993 4:24093853-24093875 CTGGTTTCCATGTGTGTAAAGGG + Intergenic
971875183 4:32299802-32299824 CCAGGTTCCCAGTGTTTAAAAGG - Intergenic
973893903 4:55393855-55393877 CAGGATTTGCTGTGCTTAAAAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975175090 4:71279413-71279435 CAGGATTTCCTGTTTTTCAAAGG + Intronic
976364890 4:84222276-84222298 AGGTATTTCCTGTTTTTAAAAGG + Intergenic
976698102 4:87939581-87939603 TTGGATTCCCTGAGTTTAATAGG + Intergenic
977197017 4:94076221-94076243 CGGGACTCCATCTTTTTAAAAGG - Intergenic
980885932 4:138762231-138762253 CCGGATTCCCTTTGTTTTAAAGG + Intergenic
982124936 4:152176221-152176243 CTGGAGTCCCAGTTTTTAAATGG + Intergenic
984658223 4:182343202-182343224 TGGAATTCACTGTGATTAAAAGG - Intronic
984818937 4:183862842-183862864 AGGGAGGCCCTGTGTTTACAAGG - Intronic
986436139 5:7733458-7733480 CAGGATTCTCTCTGTGTAAATGG - Intronic
990557510 5:56951474-56951496 CGGGAGCCCCTGGGGTTAAAGGG - Intronic
993857118 5:93090429-93090451 AGGAAATCCCTGTGTTCAAAAGG + Intergenic
995892132 5:116966554-116966576 AGTGATTTCCTGTGTTTAAGGGG - Intergenic
996097808 5:119417369-119417391 CCGGCTTCCCTATATTTAAAAGG + Intergenic
1004988981 6:21115729-21115751 CTGACTTCCCTGTGTTTCAAGGG - Intronic
1010809744 6:80287705-80287727 CTGGATTCCCTGTTTGTATAAGG + Intronic
1013980165 6:116120715-116120737 CAGGATTCCCTGGGTCTAAAGGG - Exonic
1015240253 6:131014357-131014379 AGGGATTCCTGGTTTTTAAAGGG - Intronic
1015863155 6:137701541-137701563 GGGGCTGCCCTGTGTTTATAGGG - Intergenic
1015887674 6:137935316-137935338 CAGGATTCCCTTTGTTTGAGGGG + Intergenic
1018634637 6:165849927-165849949 CAAGATTCCGTGTGATTAAAAGG - Intronic
1019063147 6:169271868-169271890 CTGTATTTCATGTGTTTAAAAGG + Intergenic
1023324259 7:39035620-39035642 TGGGATTCCCAGTTATTAAAGGG + Intronic
1024609421 7:51051594-51051616 CTGTCTTTCCTGTGTTTAAATGG + Intronic
1025823588 7:64993504-64993526 AGAGAGTCCCTGGGTTTAAAGGG + Intronic
1029610169 7:101622529-101622551 TGGGATTCCCTGTGGTTCCAGGG + Intronic
1034678239 7:152908078-152908100 TGGGAATCCCCGTTTTTAAAGGG - Intergenic
1034751649 7:153574547-153574569 CGGAATTGCCTGTGGTTAATCGG + Intergenic
1035310220 7:157962988-157963010 GGGGTTTTCCTGTCTTTAAATGG + Intronic
1035562423 8:616225-616247 CGAGTTTCTCTGTGTTCAAATGG + Intronic
1037900589 8:22686091-22686113 TTGGATTCCCTTTGTTAAAAAGG + Intergenic
1041101452 8:54399849-54399871 CGGAATTCCCAGTGTATAGATGG - Intergenic
1044572140 8:93732207-93732229 CGGTATTCCCTGTGAGTACAGGG - Exonic
1048039641 8:130713505-130713527 CAGGATTTCCTTTTTTTAAAAGG + Intergenic
1058628244 9:106958423-106958445 CTGAATACCCTGTCTTTAAAAGG + Intronic
1058699311 9:107587740-107587762 CGGGCTTCTGTGTGTATAAAGGG + Intergenic
1186722758 X:12323318-12323340 CTGGATTCCCTCTGTTCACAGGG - Intronic
1193972430 X:88071662-88071684 CCCGATTCCCTTTGTTTATAAGG - Intergenic
1197017313 X:121641677-121641699 CGGGATTTCCTGTTTATACAAGG + Intergenic
1201736789 Y:17272159-17272181 CTGGATTCCCTATATTAAAAAGG + Intergenic