ID: 947516882

View in Genome Browser
Species Human (GRCh38)
Location 2:230813760-230813782
Sequence TGGATTTAAGCTCTGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947516882 Original CRISPR TGGATTTAAGCTCTGTCTGC AGG Intronic
904287786 1:29463147-29463169 TGGATTTGAGAGCTGGCTGCTGG + Intergenic
905932053 1:41795557-41795579 GGAATTTAAGCTCCATCTGCTGG + Intronic
906166470 1:43690099-43690121 TGGATTTAAGTTCTTCCTGGAGG + Intronic
906912930 1:49975549-49975571 TGGATCTTAGCTCTGTAGGCTGG - Intronic
907093589 1:51753238-51753260 TGGATTCAAACTCAGTCTGGGGG - Intronic
907459944 1:54599515-54599537 GGGATTTAGACCCTGTCTGCAGG - Intronic
913989049 1:143592708-143592730 TGGATTAAAGCACTGGCTACTGG + Intergenic
915171331 1:153980010-153980032 TGGAGTTTCGCTCTGTCTCCAGG + Intergenic
917670454 1:177268973-177268995 TGAATGTAAGCCCTGTGTGCAGG - Intronic
918289923 1:183097585-183097607 TGGATTCAAGCACTGACTGCTGG - Intronic
918411828 1:184267182-184267204 TGGATTTAAAGCCTGTCTGCTGG - Intergenic
918568967 1:185964764-185964786 AGGATTTAGGCTCAGTCTGGAGG + Intronic
919470516 1:197973359-197973381 TGGATTTAAACTGTGGCTGCTGG - Intergenic
921667662 1:217892067-217892089 TGGAATTAAGCTCTATGTCCTGG - Intergenic
923161072 1:231315561-231315583 TGGAATTAAGCTGTGTCTTTGGG + Intergenic
923295579 1:232591590-232591612 TGCCTTTAAGCTCTCTCTTCAGG + Intergenic
924767038 1:247043238-247043260 TGGATTTAAGCATTGTCTCTGGG + Intronic
1063517208 10:6708730-6708752 TGAAATTGAGCTCTGTCTTCAGG + Intergenic
1069433942 10:68362882-68362904 TGAAGTTAAGCCCTGTCTCCAGG + Intronic
1070542796 10:77428843-77428865 GGAATCTGAGCTCTGTCTGCGGG + Intronic
1071848147 10:89540994-89541016 TCAATTTAAGCTCTGCCTCCTGG + Intronic
1074736676 10:116441721-116441743 TGGATTTGAACTCTGGCTCCAGG + Intronic
1076233240 10:128839278-128839300 TGGATCTCAGCTCTGCCTCCTGG + Intergenic
1076838321 10:133032339-133032361 GGGATTTGAGATCTGTCTGTGGG + Intergenic
1078938635 11:15976046-15976068 TGGCTTTTAGCACTGTCTGGGGG - Intronic
1081635187 11:44716535-44716557 TGGAGTTAAGCTGTTTATGCTGG + Intergenic
1082163094 11:48905664-48905686 TGAATTTTACCTCTGTGTGCAGG - Intergenic
1082175372 11:49052182-49052204 TGAATTTTATCTCTGTGTGCAGG - Intergenic
1082238314 11:49847062-49847084 TGAATTTTACCTCTGTGTGCAGG + Intergenic
1082611599 11:55305578-55305600 TGAATTTTACCTCTGTGTGCAGG + Intergenic
1082658311 11:55878087-55878109 TGAATTTTACCTCTGTGTGCAGG - Intergenic
1085796547 11:79546063-79546085 TGGGTTTAAACTCTGTCTTTGGG - Intergenic
1086690388 11:89783891-89783913 TGAATTTTACCTCTGTGTGCAGG + Intergenic
1086698269 11:89869088-89869110 TGAATTTTATCTCTGTGTGCAGG - Intergenic
1086707895 11:89975400-89975422 TGAATTTTATCTCTGTGTGCAGG + Intergenic
1086715410 11:90055752-90055774 TGAATTTTACCTCTGTGTGCAGG - Intergenic
1087273040 11:96131257-96131279 TGTTTTTAAGCTCTGTTTTCAGG - Intronic
1088351925 11:108899329-108899351 TGGTTTTAAAATCTGTCTTCAGG - Intronic
1088869820 11:113880970-113880992 TTGATTAAACCTCTTTCTGCTGG + Intergenic
1093198055 12:16152419-16152441 TGTATTTGAGCTCTGATTGCTGG + Intergenic
1099888361 12:88559429-88559451 TGGACTTAAGTTCTGAGTGCTGG + Intronic
1100024383 12:90109892-90109914 TGGATTTTTGATCTGTCTCCAGG + Intergenic
1105569094 13:21583044-21583066 TGGATTTAAGCACTGCCTAATGG + Intronic
1108594866 13:51940751-51940773 TGAATTCCTGCTCTGTCTGCAGG + Intronic
1109114363 13:58362162-58362184 TTTATTTAAGTTCTGTCAGCTGG + Intergenic
1109811673 13:67520612-67520634 AGGATTTAACATCTGCCTGCTGG + Intergenic
1111054043 13:82924553-82924575 TGGTTTTATCATCTGTCTGCTGG + Intergenic
1114594823 14:23902644-23902666 TGAATCTCAGCTTTGTCTGCCGG + Intergenic
1114761994 14:25326229-25326251 TGGATTTATCAACTGTCTGCAGG + Intergenic
1115712378 14:36065229-36065251 TAGTTTTTTGCTCTGTCTGCAGG + Intergenic
1116035065 14:39617674-39617696 TGGATAGAAGCTCTGTGAGCTGG + Intergenic
1117111340 14:52459224-52459246 TGTTTTTTAGCTCTGTCAGCAGG + Intronic
1117779589 14:59218734-59218756 TGGCTTTAATGTCTGTCTGTTGG + Intronic
1121016052 14:90549687-90549709 AGGATTCAAGCCCAGTCTGCTGG - Intronic
1125932694 15:43611711-43611733 TAGAGGTAAACTCTGTCTGCAGG - Intronic
1125945793 15:43711173-43711195 TAGAGGTAAACTCTGTCTGCAGG - Intergenic
1126862211 15:52896417-52896439 TGGCTTTAAGCTTTGTCTTAGGG + Intergenic
1128725982 15:69988949-69988971 TGAATTTAAGCTCTGGTTCCAGG + Intergenic
1129127550 15:73457129-73457151 TGCTTTTAAGCTTTGTCAGCTGG + Intronic
1129486144 15:75874306-75874328 TGAAGTTACGCTCTGTCTCCCGG + Intronic
1129712271 15:77826421-77826443 TGGATCTGAGCTGTCTCTGCAGG - Intergenic
1132366633 15:101262410-101262432 TGGTTTTCAACTCTGTTTGCTGG - Intergenic
1134165813 16:11928498-11928520 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1134494909 16:14725242-14725264 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1134500292 16:14764362-14764384 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1134526834 16:14950974-14950996 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1134545572 16:15105374-15105396 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1134580287 16:15364688-15364710 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1134714411 16:16349451-16349473 TTGATTCCAGCTCTGCCTGCAGG - Intergenic
1134722286 16:16392815-16392837 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1134945141 16:18319054-18319076 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1134952405 16:18359207-18359229 TTGATTCCAGCTCTGCCTGCAGG + Intergenic
1135311206 16:21405912-21405934 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1135364158 16:21838363-21838385 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1135447684 16:22532985-22533007 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1135516602 16:23140914-23140936 TGGATTTAAGATGTGTCTGGAGG - Intronic
1136150360 16:28343807-28343829 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1136166597 16:28457645-28457667 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1136196378 16:28657387-28657409 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1136257440 16:29051431-29051453 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1136307910 16:29384908-29384930 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1136321326 16:29486452-29486474 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1136421436 16:30136209-30136231 TGGATTTTTGCTCTGTCGCCAGG - Intergenic
1136436006 16:30226422-30226444 TTGATTCCAGCTCTGCCTGCAGG + Intronic
1139681783 16:68570639-68570661 TTGCTTTCAGCACTGTCTGCTGG + Intronic
1139855602 16:69977341-69977363 TTGATTCCAGCTCTGCCTGCAGG + Intergenic
1140367132 16:74390750-74390772 TTGATTCCAGCTCTGCCTGCAGG - Intronic
1143571396 17:7760947-7760969 TGGATTGAAAGTCTGTCTGTAGG + Intronic
1143755722 17:9065939-9065961 TGGATTTAATCTCTGGCTAAAGG - Intronic
1150737437 17:67752612-67752634 TGGATTTAAACTCAATCTTCTGG + Intergenic
1151163133 17:72182739-72182761 TTGTTTTAAGCTCTGTCAACAGG - Intergenic
1151225553 17:72645442-72645464 AGGATCTAAGCTCTGGCAGCTGG + Intergenic
1151863639 17:76784822-76784844 TTGATGTAACCTCTGTCTCCTGG - Intergenic
1151895985 17:76981324-76981346 TGGATTAAAGCCATGTCTCCTGG + Intergenic
1152834990 17:82523793-82523815 TGAATTTAAGCTCAGTGTTCAGG + Intronic
1152835427 17:82527213-82527235 TGTATTTAAGCTCCGCCTCCTGG + Intronic
1154117072 18:11620529-11620551 TTGATTCCAGCTCTGCCTGCAGG + Intergenic
1155374335 18:25139293-25139315 TGGATTCAACCTCTGCCTCCTGG - Intronic
1155930870 18:31706777-31706799 TCTATTTAAGCTCTTTCAGCTGG - Intergenic
1157283153 18:46359252-46359274 TGGGGTTATGGTCTGTCTGCTGG + Intronic
1159088207 18:63818376-63818398 TGGACTGAAGCTCTGTCTTCTGG + Intergenic
1161938867 19:7389817-7389839 GGGAATTAAGCTCTTTCTCCTGG + Intronic
1162595134 19:11622843-11622865 TGGAGTAAAGCTCTGTCTCCCGG + Intergenic
1163656447 19:18548364-18548386 TGGAGTCTAGCTCTGTCTCCAGG - Intergenic
1164325250 19:24185666-24185688 TCGTTTTAGGTTCTGTCTGCAGG - Intergenic
1167127939 19:47564053-47564075 TGGGTTTAAGATCTGGCTGTTGG - Intergenic
925990517 2:9250777-9250799 TGGAATTAAGCTATACCTGCGGG + Intronic
927863388 2:26574245-26574267 TGGACTAAAGTTCAGTCTGCTGG + Intronic
929454742 2:42057791-42057813 GGGATGTTAGCTTTGTCTGCAGG - Exonic
929601856 2:43209577-43209599 TTCACTTAACCTCTGTCTGCTGG + Intergenic
931960762 2:67479823-67479845 TGGTTTTAAGCTCTGGGAGCAGG + Intergenic
934137996 2:89016665-89016687 TGGAGTTAAGGGATGTCTGCTGG + Intergenic
934143106 2:89067747-89067769 TGGAGTTAAGGGATGTCTGCTGG + Intergenic
934226137 2:90132808-90132830 TGGAGTTAAGGGATGTCTGCTGG - Intergenic
937531090 2:122828349-122828371 TTGATGAAAGCTATGTCTGCTGG - Intergenic
937786951 2:125911558-125911580 TGTTTTGAAGCTTTGTCTGCTGG + Intergenic
940003826 2:148993627-148993649 TAGATTAAAGCTCAGTCTCCAGG + Intronic
941616574 2:167727180-167727202 TGGATTTAACCTTTGTCTTTTGG + Intergenic
943872069 2:193012149-193012171 TGGATTCATGCTCTGCCTTCAGG - Intergenic
946806919 2:223479976-223479998 TGGTTTTAAGTTCTGTGTGTGGG + Intergenic
947516882 2:230813760-230813782 TGGATTTAAGCTCTGTCTGCAGG + Intronic
1169980249 20:11376760-11376782 TTGATTTCAGCTCAGTTTGCTGG - Intergenic
1169980742 20:11380845-11380867 TGTTTTTCAGCTCTGTCAGCTGG - Intergenic
1170877613 20:20265525-20265547 TGGCTTTATGCACTGGCTGCTGG - Intronic
1175648523 20:60696423-60696445 TTGCTTCAAGCTCTATCTGCTGG - Intergenic
1178584087 21:33858418-33858440 TGGAGTTAAGACCTGTCTCCTGG + Intronic
1178717418 21:34978792-34978814 TTGTTTAAACCTCTGTCTGCTGG + Intronic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
951028207 3:17851847-17851869 TGGTTTTAAAATCTGTCTACAGG + Intronic
952275588 3:31872694-31872716 TTGATGTAACCTCTGTCTCCTGG + Intronic
959137919 3:102448203-102448225 TGCACATAAACTCTGTCTGCAGG + Intronic
959603443 3:108215486-108215508 TGGAGTGAACCTCTGCCTGCCGG - Intronic
961166952 3:124770092-124770114 GGGAGCTAAGCTCTGGCTGCCGG + Intronic
963675883 3:148310779-148310801 TGGATTTAAGTTGTTTGTGCAGG - Intergenic
969903767 4:10373939-10373961 TGCTTTTCAGCTCTGTGTGCAGG - Intergenic
973769109 4:54190397-54190419 TGGAGTTTTGCTCTGTCTCCGGG - Intronic
975375996 4:73646291-73646313 GGAATTCAAGCTCTGACTGCTGG + Intergenic
978985049 4:115001939-115001961 TACTTATAAGCTCTGTCTGCTGG + Intronic
983549594 4:169002544-169002566 TGGCTTTAACCTCTACCTGCTGG - Intronic
986440537 5:7777486-7777508 TGGAGATAGGCTCTGTCTTCAGG - Intronic
992154041 5:73937128-73937150 TGGATATCAGTGCTGTCTGCAGG + Intronic
995185686 5:109267858-109267880 TGGACCTAAACTCAGTCTGCTGG - Intergenic
1000231616 5:159320677-159320699 TGAATTTAAGCTTTTTCTCCTGG - Intronic
1000642206 5:163716235-163716257 TGTATTTACTCTCTGTCTACTGG - Intergenic
1000938155 5:167328230-167328252 TGGATTTTTGCTCTGTCGCCAGG + Intronic
1005698904 6:28379956-28379978 TGGATTTGTGATCTGTCTCCTGG - Exonic
1006733714 6:36256471-36256493 TGGAGTTTTGCTCTGTCTCCAGG + Intronic
1006737050 6:36281267-36281289 TGGATTTCAGTCCTGGCTGCTGG + Intronic
1009537960 6:64914172-64914194 TGCATTTACTCTCTATCTGCAGG - Intronic
1010802815 6:80197698-80197720 TGGCTTTAAGCCTTGTCTACTGG + Intronic
1012033729 6:94104887-94104909 TGGTTTTCAGCTCTGTTAGCAGG - Intergenic
1021453742 7:20806530-20806552 TGTATTTTTGCTCTGTCAGCTGG + Intergenic
1022481289 7:30744763-30744785 TGGCTTTATGGACTGTCTGCAGG + Intronic
1022804326 7:33806919-33806941 TGCATTTGAGCTTTGTCAGCTGG + Intergenic
1022974102 7:35541583-35541605 TGAATATAATGTCTGTCTGCAGG + Intergenic
1023754425 7:43402610-43402632 TGGATTTTATCTCTGTATGCTGG - Intronic
1024022926 7:45387565-45387587 TGTCTTGAGGCTCTGTCTGCAGG + Intergenic
1026425948 7:70293864-70293886 TGGCTTGAAGCTCTGTATGGTGG + Intronic
1027112320 7:75449986-75450008 TGGAGTCATGCTCTGTCTCCAGG - Intronic
1027284553 7:76634528-76634550 TGGAGTCATGCTCTGTCTCCAGG - Intergenic
1027441013 7:78219200-78219222 TGGTTTTAGCTTCTGTCTGCAGG + Intronic
1032354366 7:131195922-131195944 TGGAGTCTAGCTCTGTCTCCAGG - Intronic
1032594779 7:133228461-133228483 TGGAGTTTTGCTCTGTCTCCAGG - Intergenic
1035254402 7:157617062-157617084 TGGATTTCAGCTCTGACGGGCGG + Exonic
1036060644 8:5315468-5315490 TGGCTCTCAGCTCTGTCTTCTGG + Intergenic
1041099640 8:54383054-54383076 TGGATTAAACCTCTGACTTCTGG - Intergenic
1041702216 8:60803841-60803863 TGGATTCAATCTATGCCTGCTGG + Intronic
1042408077 8:68429152-68429174 TGGATATAAGATCTGTATGGGGG - Intronic
1043134359 8:76502644-76502666 TGGATTTAGACTTTGTTTGCAGG - Intergenic
1043473372 8:80582902-80582924 TGGATTTAAGCTATTTCAACAGG + Intergenic
1045254016 8:100504079-100504101 TGGATTTAAGCTCGGCTTCCTGG - Intergenic
1045328210 8:101133010-101133032 TGGTTTTTACCTCTCTCTGCAGG + Intergenic
1046265536 8:111824827-111824849 TGGAGTTTTGCTCTGTCTCCAGG + Intergenic
1047215489 8:122872803-122872825 TGGATCTAAGCAATGTCTGCAGG + Intronic
1047519206 8:125581516-125581538 TGGAGTTTTGCTCTGTCTCCAGG + Intergenic
1047625428 8:126651502-126651524 TGGAGTCTAGCTCTGTCTCCAGG + Intergenic
1048921019 8:139230238-139230260 TGGGTTGAATCTCTGTCTCCTGG - Intergenic
1050271229 9:3947549-3947571 TGTGTTTAAGATCTGTGTGCAGG + Intronic
1051370600 9:16355752-16355774 TGGATTTAAGATTGGTCTGGAGG - Intergenic
1052736160 9:32344720-32344742 TGCATTCAAGCTCTGTATTCAGG + Intergenic
1054789287 9:69240049-69240071 TGGATTTAACCTTTGTCTCATGG - Exonic
1056218442 9:84427670-84427692 TGGATTTAATCACTGTCTGATGG + Intergenic
1058595843 9:106614828-106614850 TAGATTTAAGCTCTAACTCCGGG - Intergenic
1059455272 9:114396651-114396673 TGGAGTCTAGCTCTGTCTCCAGG - Intergenic
1060480741 9:124015595-124015617 TGGATTGAATCTCTGTGTGCTGG + Intronic
1060561988 9:124553282-124553304 TGTATCTAAGCTCTCTCTGTGGG + Intronic
1061867045 9:133497633-133497655 TGGACTTGAGCTCTGACAGCAGG - Intergenic
1186153705 X:6703898-6703920 TAGATTAAACCTCTCTCTGCAGG - Intergenic
1186960101 X:14727255-14727277 TGGGTTTCAGCTCTGGCTGCTGG - Intronic
1187631751 X:21180777-21180799 TGGATTTCTACTCTATCTGCAGG + Intergenic
1191965947 X:66758290-66758312 TATATTTAAGCTGTGTCTTCAGG - Intergenic
1194563948 X:95458659-95458681 TGGATGTAGGCTTTGTCTACAGG + Intergenic
1195613591 X:106895343-106895365 AAGATTTAAGTTCTGGCTGCAGG - Intronic
1201894589 Y:18979961-18979983 GAGGTTTAAGCTCTGCCTGCAGG + Intergenic