ID: 947521052

View in Genome Browser
Species Human (GRCh38)
Location 2:230846351-230846373
Sequence CAGGTACAGCATGACTAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947521046_947521052 15 Left 947521046 2:230846313-230846335 CCTGTTCTACCTCCTCTGAACAC No data
Right 947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG No data
947521048_947521052 3 Left 947521048 2:230846325-230846347 CCTCTGAACACATTCTTTCCTCA No data
Right 947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG No data
947521047_947521052 6 Left 947521047 2:230846322-230846344 CCTCCTCTGAACACATTCTTTCC No data
Right 947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG No data
947521045_947521052 16 Left 947521045 2:230846312-230846334 CCCTGTTCTACCTCCTCTGAACA No data
Right 947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG No data
947521044_947521052 26 Left 947521044 2:230846302-230846324 CCTTTGAGCTCCCTGTTCTACCT No data
Right 947521052 2:230846351-230846373 CAGGTACAGCATGACTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947521052 Original CRISPR CAGGTACAGCATGACTAGTT AGG Intergenic
No off target data available for this crispr