ID: 947523599

View in Genome Browser
Species Human (GRCh38)
Location 2:230865762-230865784
Sequence CGCTGCGGCCTCTGGACGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
947523592_947523599 16 Left 947523592 2:230865723-230865745 CCAGAAAGTGATGAAATGGAAAT 0: 1
1: 0
2: 2
3: 41
4: 390
Right 947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 81
947523595_947523599 -10 Left 947523595 2:230865749-230865771 CCAGAACCGACGGCGCTGCGGCC 0: 1
1: 0
2: 1
3: 11
4: 48
Right 947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 81
947523590_947523599 30 Left 947523590 2:230865709-230865731 CCGGAATTGACAGACCAGAAAGT 0: 1
1: 0
2: 1
3: 20
4: 163
Right 947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
947523599 Original CRISPR CGCTGCGGCCTCTGGACGTC GGG Intronic
900189068 1:1345698-1345720 GGCTGTGGCCTCTGGGAGTCTGG - Intronic
900317068 1:2062305-2062327 CCCTGCGGATTCTGGACGTTTGG + Intronic
901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG + Intronic
901676382 1:10888506-10888528 AGCTGTGGGCTCTGGGCGTCTGG - Intergenic
903540818 1:24095273-24095295 CCCTGCGGCCTTTAGAAGTCAGG + Intronic
905953368 1:41971927-41971949 TGCTGCGTCCTCTGGAGGGCAGG - Intronic
907178892 1:52553022-52553044 CGCTGCCGCCGCTGGAGGCCGGG + Intronic
907489763 1:54801286-54801308 CGCTGCGGCCTCTCGGTCTCAGG + Intergenic
919856437 1:201709455-201709477 CTCTGCAGCCTCTGGAGCTCTGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1067732150 10:48820262-48820284 AGCTGCGGCCTCAGGACTGCTGG - Exonic
1070759749 10:79016675-79016697 CTCTCCTGCCTCTGGACTTCTGG - Intergenic
1073329502 10:102661248-102661270 CGCTGCGGGCTCAGCACATCTGG - Intergenic
1077433899 11:2529162-2529184 TCCTACTGCCTCTGGACGTCTGG - Intronic
1078334165 11:10450864-10450886 CGCTGCGCCCTCTGAACGCCCGG + Exonic
1078753964 11:14191186-14191208 CGCTGCTGCCTCTGGTGGCCTGG + Intronic
1083871946 11:65493933-65493955 CACTGCGGCCTCTGGGCTCCAGG + Intergenic
1091207881 11:133833438-133833460 CGCAGAAGCCTCTGGGCGTCGGG + Intergenic
1092002480 12:5043970-5043992 GGCAGCGGCTTCTTGACGTCAGG + Exonic
1097021584 12:56024777-56024799 CCCTGCTTCCTGTGGACGTCAGG + Intronic
1101396334 12:104351768-104351790 CGCTGCAGCCTCTGACCTTCTGG + Intergenic
1105684876 13:22770976-22770998 CGCCGGGGCCTCTGGACCACTGG + Intergenic
1107408721 13:40139028-40139050 CGCTGAGGCCTCTGGAGGCTGGG - Intergenic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1112650313 13:101389555-101389577 CTCTGCTGCCTCTGGACTGCTGG - Intronic
1113885678 13:113657297-113657319 CCCTGCGACCCCTGGGCGTCGGG - Intronic
1113894427 13:113754739-113754761 CGCTGCGACCTGTGAGCGTCCGG - Intergenic
1115804797 14:37038837-37038859 GGCTGGGGCCACAGGACGTCAGG - Intronic
1122703700 14:103607225-103607247 CGCTGGGGGCTCAGGACGACAGG - Intronic
1123588913 15:21835420-21835442 AGCTGGGGCCTCTGCATGTCAGG - Intergenic
1126668299 15:51094289-51094311 CGCGGCGGGCTCTGGTCGCCCGG - Intronic
1132470557 16:100495-100517 CTCTGCAGCCTGTGCACGTCGGG - Exonic
1138848911 16:60603191-60603213 CTCTGCAGCCTCTGAACATCTGG - Intergenic
1141280648 16:82627549-82627571 CGCTTCGGCCGCTGGGCGTTGGG - Intronic
1142805461 17:2368998-2369020 CCCTGAGGCCTCTGGACCCCTGG - Intronic
1142901579 17:3015426-3015448 CCCTGGGCTCTCTGGACGTCAGG - Intronic
1143106904 17:4534611-4534633 CACTGCGGCCCCTGCACTTCGGG + Intronic
1144856247 17:18269817-18269839 GGCTGCGGCCTCTGGCAGGCAGG + Intergenic
1148078719 17:44955575-44955597 TAGTGCGGCCTCTGGACCTCTGG + Intergenic
1148805682 17:50262728-50262750 CACTGCTGCCTCTTGACGTGGGG + Intergenic
1152615028 17:81334008-81334030 CGCAGCGGGCTCTGGCCATCAGG + Intergenic
1153467018 18:5398943-5398965 CGCTGTGTCGTCTGGACCTCTGG + Intronic
1161175899 19:2841919-2841941 CGCTGCGGCTTCGGGACCCCCGG + Intronic
1161594067 19:5142339-5142361 CGCTGTGGCCACAGGAGGTCGGG - Intronic
1165242837 19:34481637-34481659 CGCTGCGGCCTCTGGAATGTGGG - Exonic
1165821559 19:38679665-38679687 CACTGCGGCCTCTGAACTCCTGG + Intronic
1166296475 19:41892498-41892520 GGCAGCGGCCTCAGGACGTGTGG + Intronic
1166998720 19:46732461-46732483 CTCTCCTGCCTCTGGACCTCGGG + Intronic
925203911 2:1990786-1990808 CGCTGAGGGCTCTAGACGACTGG - Intronic
938066127 2:128282917-128282939 ATCTGGGGCCTCTGGACCTCAGG + Intronic
947518008 2:230823789-230823811 TGCTGCGGGCTCTGGAAGGCAGG - Intergenic
947523599 2:230865762-230865784 CGCTGCGGCCTCTGGACGTCGGG + Intronic
1175265903 20:57703409-57703431 CAGTGGGGCATCTGGACGTCAGG + Intronic
1179820365 21:43933747-43933769 CGCCGGGGCCTCTGGGCATCTGG - Intronic
1181637486 22:24181196-24181218 AGCTTCGCCCTCTGGACATCCGG + Intergenic
1182295055 22:29307424-29307446 CGCTGCGCCGCCTGGACGCCGGG + Intronic
1182485055 22:30634577-30634599 CGCTGCGCCCTCTGGTGGCCAGG - Intergenic
1183949687 22:41345912-41345934 CGCTGCGGCCTGTGGGGCTCTGG - Intronic
950610509 3:14124087-14124109 CGCTGCGACCTTTGTAAGTCAGG - Intronic
968579232 4:1382134-1382156 AGCTGCTGCCTCTGGGCATCAGG - Intronic
968997194 4:3953317-3953339 CCCTGCGGCATCTGAATGTCAGG - Intergenic
978835101 4:113139809-113139831 CACTGCTGCCTCTTGACTTCTGG - Intronic
986132149 5:4942000-4942022 CGCTGTGGTCACTGGACGGCTGG - Intergenic
986267393 5:6202320-6202342 TGCTGGTGCCTCTGGGCGTCGGG - Intergenic
986623983 5:9706430-9706452 CGCTGTGGCCTCTGAGAGTCTGG - Intronic
997782811 5:136676920-136676942 AGCTGTGGCCTCCGGATGTCAGG + Intergenic
998463427 5:142325438-142325460 CGCTGCGGCCTCCGGATCCCGGG + Intronic
1001825979 5:174745377-174745399 CGCTGCAGCCTCTGGAGGGGAGG + Intergenic
1002062855 5:176636618-176636640 CTCTGAGGCCTCTGGACAGCAGG - Intronic
1017727331 6:157284614-157284636 CGCTCCAGCCTTTGGACTTCAGG - Intergenic
1017740334 6:157400647-157400669 CGCTGCTGCCCATGGATGTCAGG + Intronic
1019567616 7:1692347-1692369 GGCTGCTCCCTCTGGCCGTCTGG + Intronic
1020007886 7:4792047-4792069 GGCTGCGGCCTCTGGCCATTCGG + Intronic
1021998569 7:26202396-26202418 CGCTTAGGCCTCTGGACGCCGGG + Intronic
1033333831 7:140435730-140435752 CGCTGCGGCCTGTGGGCCCCAGG - Intergenic
1039818383 8:41114787-41114809 CGGTGTGGCCTCAGGAGGTCAGG + Intergenic
1043053257 8:75407456-75407478 CGCTGCGGTCTCGGGAGGCCGGG + Intergenic
1049762324 8:144337034-144337056 GGCTGCGGGCTCTGGAGGCCGGG - Intergenic
1053489738 9:38489373-38489395 CGCTGCGGCCTCCTAACGGCGGG + Intergenic
1057670073 9:97078682-97078704 CGCTGCGGCCTCCTAACGGCGGG + Intergenic
1059111567 9:111562754-111562776 CGCTGGGGCCTGTGGAAGCCGGG - Intronic
1062119699 9:134827686-134827708 GGCTGCAGCCTGTGGACGCCTGG - Intronic
1187155804 X:16719677-16719699 CGCTGCGGTCTCTGGGGATCGGG + Exonic
1190176751 X:48156823-48156845 CGCTTCGGCCTCAGGACTACAGG + Intergenic
1200034613 X:153319422-153319444 CGCAGCAGCCTCAGGAAGTCAGG + Intergenic